Incidental Mutation 'R4378:Amigo2'
ID325214
Institutional Source Beutler Lab
Gene Symbol Amigo2
Ensembl Gene ENSMUSG00000048218
Gene Nameadhesion molecule with Ig like domain 2
Synonyms
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location97244125-97247287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97245978 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 188 (F188L)
Ref Sequence ENSEMBL: ENSMUSP00000155019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053106] [ENSMUST00000059433] [ENSMUST00000229890]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053106
AA Change: F188L

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000059913
Gene: ENSMUSG00000048218
AA Change: F188L

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 39 71 7e-1 SMART
LRR 91 114 2.63e0 SMART
LRR 115 138 6.96e0 SMART
LRR_TYP 139 162 4.47e-3 SMART
LRR 163 186 1.07e0 SMART
LRR 190 214 1.06e2 SMART
LRRCT 227 282 4.74e-3 SMART
IGc2 300 369 9.34e-4 SMART
transmembrane domain 397 419 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
low complexity region 501 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059433
SMART Domains Protein: ENSMUSP00000055485
Gene: ENSMUSG00000044250

DomainStartEndE-ValueType
Pfam:PC-Esterase 1 254 5.1e-53 PFAM
low complexity region 295 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226615
Predicted Effect possibly damaging
Transcript: ENSMUST00000229890
AA Change: F188L

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.0623 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Amigo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Amigo2 APN 15 97245446 missense possibly damaging 0.84
IGL01451:Amigo2 APN 15 97245226 missense probably benign 0.22
IGL01510:Amigo2 APN 15 97245081 missense probably benign
IGL02496:Amigo2 APN 15 97245613 nonsense probably null
IGL02720:Amigo2 APN 15 97245697 nonsense probably null
R0288:Amigo2 UTSW 15 97245679 missense probably damaging 1.00
R0377:Amigo2 UTSW 15 97246380 missense possibly damaging 0.93
R0696:Amigo2 UTSW 15 97245974 missense probably benign 0.00
R1188:Amigo2 UTSW 15 97245713 missense probably benign 0.37
R1639:Amigo2 UTSW 15 97245998 missense probably benign 0.10
R3076:Amigo2 UTSW 15 97245434 missense probably damaging 0.98
R3837:Amigo2 UTSW 15 97245315 missense probably damaging 0.99
R5196:Amigo2 UTSW 15 97246061 missense probably damaging 1.00
R5698:Amigo2 UTSW 15 97245726 nonsense probably null
R6191:Amigo2 UTSW 15 97245538 missense probably benign 0.42
R6326:Amigo2 UTSW 15 97245375 missense probably benign 0.00
R6738:Amigo2 UTSW 15 97245464 missense possibly damaging 0.82
R7102:Amigo2 UTSW 15 97245860 missense probably damaging 1.00
R7253:Amigo2 UTSW 15 97245075 missense probably benign 0.03
R7615:Amigo2 UTSW 15 97245342 missense probably damaging 1.00
R8269:Amigo2 UTSW 15 97246231 missense possibly damaging 0.84
R8304:Amigo2 UTSW 15 97246157 missense probably damaging 1.00
R8333:Amigo2 UTSW 15 97245285 missense probably damaging 1.00
R8888:Amigo2 UTSW 15 97245508 missense probably damaging 1.00
R8895:Amigo2 UTSW 15 97245508 missense probably damaging 1.00
X0018:Amigo2 UTSW 15 97245893 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACAGGCGACAGGTATAGTC -3'
(R):5'- TGAAGTCGGTAAAGAGTGCCAC -3'

Sequencing Primer
(F):5'- GAGCTAAAGTGCCTACGGTACC -3'
(R):5'- GTCGGTAAAGAGTGCCACATTCC -3'
Posted On2015-07-06