Incidental Mutation 'R4378:Cyp4f40'
ID325215
Institutional Source Beutler Lab
Gene Symbol Cyp4f40
Ensembl Gene ENSMUSG00000090700
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 40
SynonymsEG631304
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32659410-32676687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32668029 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 158 (N158S)
Ref Sequence ENSEMBL: ENSMUSP00000129536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165061]
Predicted Effect probably null
Transcript: ENSMUST00000165061
AA Change: N158S

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129536
Gene: ENSMUSG00000090700
AA Change: N158S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 52 515 2.2e-130 PFAM
Meta Mutation Damage Score 0.1746 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F11, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F2, is approximately 16 kb away. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Cyp4f40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Cyp4f40 APN 17 32667974 missense probably benign 0.00
IGL01563:Cyp4f40 APN 17 32673956 missense probably damaging 0.99
IGL01801:Cyp4f40 APN 17 32676305 missense probably damaging 1.00
IGL01960:Cyp4f40 APN 17 32659561 missense probably benign 0.25
IGL02387:Cyp4f40 APN 17 32668010 missense probably damaging 1.00
IGL02631:Cyp4f40 APN 17 32675635 splice site probably benign
IGL02967:Cyp4f40 APN 17 32674248 missense probably damaging 1.00
R0030:Cyp4f40 UTSW 17 32675973 missense probably damaging 1.00
R0103:Cyp4f40 UTSW 17 32676308 missense probably damaging 1.00
R0103:Cyp4f40 UTSW 17 32676309 nonsense probably null
R0180:Cyp4f40 UTSW 17 32659667 missense probably benign 0.00
R1413:Cyp4f40 UTSW 17 32673939 missense probably benign 0.35
R2882:Cyp4f40 UTSW 17 32668073 missense probably benign 0.05
R3903:Cyp4f40 UTSW 17 32659624 missense possibly damaging 0.51
R4465:Cyp4f40 UTSW 17 32671212 missense probably benign 0.00
R4808:Cyp4f40 UTSW 17 32674275 missense probably benign 0.23
R5377:Cyp4f40 UTSW 17 32675616 missense probably null 0.61
R5395:Cyp4f40 UTSW 17 32669853 missense probably benign 0.01
R5523:Cyp4f40 UTSW 17 32669822 missense probably damaging 0.98
R5889:Cyp4f40 UTSW 17 32675757 missense probably benign 0.15
R6624:Cyp4f40 UTSW 17 32671180 missense possibly damaging 0.82
R6692:Cyp4f40 UTSW 17 32675742 missense possibly damaging 0.48
R6859:Cyp4f40 UTSW 17 32675949 missense probably benign 0.19
R7792:Cyp4f40 UTSW 17 32671169 missense probably damaging 1.00
R8324:Cyp4f40 UTSW 17 32659528 missense probably benign 0.35
R8711:Cyp4f40 UTSW 17 32675988 critical splice donor site probably benign
R8755:Cyp4f40 UTSW 17 32667983 nonsense probably null
R8913:Cyp4f40 UTSW 17 32667836 missense probably benign 0.05
Z1088:Cyp4f40 UTSW 17 32674002 splice site probably null
Z1177:Cyp4f40 UTSW 17 32671159 missense probably benign 0.04
Z1177:Cyp4f40 UTSW 17 32676449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGCCCCAAAGGACGACATC -3'
(R):5'- CACACATGGGGAATCAAGTCTG -3'

Sequencing Primer
(F):5'- ACAGCTTCTTGAAACCCTGG -3'
(R):5'- TCAAGTCTGGGGGAAAACTGC -3'
Posted On2015-07-06