Incidental Mutation 'R4378:Nars'
ID325217
Institutional Source Beutler Lab
Gene Symbol Nars
Ensembl Gene ENSMUSG00000024587
Gene Nameasparaginyl-tRNA synthetase
SynonymsASNRS
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location64499665-64516557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64501353 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 500 (Y500H)
Ref Sequence ENSEMBL: ENSMUSP00000025483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025483]
Predicted Effect probably damaging
Transcript: ENSMUST00000025483
AA Change: Y500H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025483
Gene: ENSMUSG00000024587
AA Change: Y500H

DomainStartEndE-ValueType
coiled coil region 80 112 N/A INTRINSIC
Pfam:tRNA_anti-codon 139 219 1.2e-12 PFAM
Pfam:tRNA-synt_2 236 554 1.8e-108 PFAM
Meta Mutation Damage Score 0.8841 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. Asparaginyl-tRNA synthetase is localized to the cytoplasm and belongs to the class II family of tRNA synthetases. The N-terminal domain represents the signature sequence for the eukaryotic asparaginyl-tRNA synthetases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Nars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Nars APN 18 64504968 missense probably damaging 1.00
IGL01962:Nars APN 18 64510483 missense probably benign 0.00
IGL01968:Nars APN 18 64507858 missense probably damaging 1.00
IGL02288:Nars APN 18 64510535 splice site probably benign
IGL02366:Nars APN 18 64503528 missense possibly damaging 0.70
IGL02948:Nars APN 18 64505195 missense possibly damaging 0.66
FR4976:Nars UTSW 18 64510445 critical splice donor site probably benign
R0591:Nars UTSW 18 64500567 missense probably damaging 1.00
R1654:Nars UTSW 18 64512049 missense probably damaging 1.00
R1691:Nars UTSW 18 64516414 critical splice donor site probably null
R1954:Nars UTSW 18 64500564 missense probably damaging 1.00
R2006:Nars UTSW 18 64505028 missense probably damaging 1.00
R2516:Nars UTSW 18 64505016 missense probably damaging 1.00
R3433:Nars UTSW 18 64509303 missense probably damaging 1.00
R4667:Nars UTSW 18 64505231 missense possibly damaging 0.93
R4737:Nars UTSW 18 64516427 missense probably benign
R4877:Nars UTSW 18 64500572 nonsense probably null
R5950:Nars UTSW 18 64510485 missense possibly damaging 0.91
R6434:Nars UTSW 18 64507801 missense probably benign 0.01
R6920:Nars UTSW 18 64501400 missense probably damaging 0.99
R7082:Nars UTSW 18 64504354 missense possibly damaging 0.68
R7132:Nars UTSW 18 64507770 critical splice donor site probably null
R7504:Nars UTSW 18 64512022 missense probably benign 0.22
R8120:Nars UTSW 18 64504351 missense probably benign 0.19
R8343:Nars UTSW 18 64504387 missense probably benign 0.01
R8429:Nars UTSW 18 64501320 missense probably damaging 1.00
R8929:Nars UTSW 18 64511824 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAAACTGACGTATAACTGGGC -3'
(R):5'- TGAGTACTACTTGAACTTTGCGTAG -3'

Sequencing Primer
(F):5'- CTGACGTATAACTGGGCTAAAGAC -3'
(R):5'- GAACTTTGCGTAGTCACATAGC -3'
Posted On2015-07-06