Incidental Mutation 'R4378:Zfp516'
ID325219
Institutional Source Beutler Lab
Gene Symbol Zfp516
Ensembl Gene ENSMUSG00000058881
Gene Namezinc finger protein 516
SynonymsC330029B10Rik, Zfp26l
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location82910879-83005314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82987180 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 736 (D736E)
Ref Sequence ENSEMBL: ENSMUSP00000126629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071233] [ENSMUST00000171238]
Predicted Effect probably benign
Transcript: ENSMUST00000071233
AA Change: D736E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071216
Gene: ENSMUSG00000058881
AA Change: D736E

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171238
AA Change: D736E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126629
Gene: ENSMUSG00000058881
AA Change: D736E

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Meta Mutation Damage Score 0.0897 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a zinc-finger protein, and belongs to the krueppel C2H2-type zinc-finger protein family. It may be involved in transcriptional regulation. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr1165-ps G T 2: 88,101,485 N167K unknown Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Zfp516
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Zfp516 APN 18 82957108 missense probably benign 0.08
IGL01343:Zfp516 APN 18 82993096 missense probably damaging 0.99
IGL01413:Zfp516 APN 18 82987670 nonsense probably null
IGL01684:Zfp516 APN 18 82957201 missense probably damaging 1.00
IGL01820:Zfp516 APN 18 82987361 missense probably benign 0.00
IGL02081:Zfp516 APN 18 82955733 missense probably benign 0.00
IGL02209:Zfp516 APN 18 82994497 missense probably benign
IGL02253:Zfp516 APN 18 82994497 missense probably benign
IGL03028:Zfp516 APN 18 82955913 missense possibly damaging 0.95
IGL03241:Zfp516 APN 18 82987520 missense probably benign 0.01
R0379:Zfp516 UTSW 18 82987670 nonsense probably null
R0426:Zfp516 UTSW 18 82955772 missense probably benign 0.04
R0466:Zfp516 UTSW 18 82957454 splice site probably null
R0715:Zfp516 UTSW 18 82987263 missense probably damaging 1.00
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R2110:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2112:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2162:Zfp516 UTSW 18 82986938 missense possibly damaging 0.95
R2223:Zfp516 UTSW 18 82955770 missense possibly damaging 0.94
R4097:Zfp516 UTSW 18 82987256 missense possibly damaging 0.95
R4299:Zfp516 UTSW 18 82987497 missense possibly damaging 0.80
R4601:Zfp516 UTSW 18 82956039 missense probably benign 0.14
R4721:Zfp516 UTSW 18 82957111 missense possibly damaging 0.49
R4946:Zfp516 UTSW 18 82956094 missense probably benign 0.06
R5186:Zfp516 UTSW 18 82957093 missense probably benign
R5351:Zfp516 UTSW 18 82956751 missense probably benign 0.00
R5937:Zfp516 UTSW 18 82956833 missense probably damaging 0.99
R5998:Zfp516 UTSW 18 82956514 missense probably damaging 1.00
R6458:Zfp516 UTSW 18 82987350 missense probably benign 0.03
R6513:Zfp516 UTSW 18 82955710 missense probably damaging 1.00
R6626:Zfp516 UTSW 18 82988107 missense probably damaging 1.00
R6712:Zfp516 UTSW 18 82957308 missense probably damaging 1.00
R6877:Zfp516 UTSW 18 82955791 missense probably damaging 1.00
R6886:Zfp516 UTSW 18 82957000 missense probably benign 0.06
R7073:Zfp516 UTSW 18 82988200 critical splice donor site probably null
R7463:Zfp516 UTSW 18 82957108 missense probably benign 0.08
R7863:Zfp516 UTSW 18 83001328 missense probably benign 0.00
R7946:Zfp516 UTSW 18 83001328 missense probably benign 0.00
R8097:Zfp516 UTSW 18 82987170 nonsense probably null
X0019:Zfp516 UTSW 18 82987488 missense probably damaging 1.00
X0065:Zfp516 UTSW 18 82987169 missense probably damaging 1.00
Z1176:Zfp516 UTSW 18 82987533 missense probably benign 0.01
Z1177:Zfp516 UTSW 18 82956066 missense probably damaging 1.00
Z1177:Zfp516 UTSW 18 82956067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCCAGCATTTCACCCC -3'
(R):5'- GAATGCTCTTGTGGCCACTG -3'

Sequencing Primer
(F):5'- ACTACTGACCGGGTAGACTTC -3'
(R):5'- ACTGGGCTGAGTCCAAGG -3'
Posted On2015-07-06