Mutagenetix > Incidental Mutation

Incidental Mutation 'R4378:Zfp516'

325219

Institutional Source

Beutler Lab

Gene Symbol

Zfp516

Ensembl Gene

ENSMUSG00000058881

Gene Name

zinc finger protein 516

Synonyms

C330029B10Rik, Zfp26l

MMRRC Submission

041121-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.359) question?

Stock #

R4378 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82910879-83005314 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 82987180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 736 (D736E)

Ref Sequence

ENSEMBL: ENSMUSP00000126629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071233] [ENSMUST00000171238]

AlphaFold

Q7TSH3

Predicted Effect

probably benign
Transcript: ENSMUST00000071233
AA Change: D736E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000071216
Gene: ENSMUSG00000058881
AA Change: D736E

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
ZnF_C2H2	34	56	1.03e-2	SMART
ZnF_C2H2	62	84	3.95e-4	SMART
ZnF_C2H2	162	185	8.09e-1	SMART
ZnF_C2H2	188	211	1.76e-1	SMART
ZnF_C2H2	236	258	3.16e-3	SMART
ZnF_C2H2	264	286	3.34e-2	SMART
ZnF_C2H2	323	345	2.63e0	SMART
ZnF_C2H2	504	526	5.72e-1	SMART
low complexity region	527	544	N/A	INTRINSIC
ZnF_C2H2	753	776	2.97e1	SMART
low complexity region	834	846	N/A	INTRINSIC
ZnF_C2H2	1092	1114	1.12e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171238
AA Change: D736E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000126629
Gene: ENSMUSG00000058881
AA Change: D736E

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
ZnF_C2H2	34	56	1.03e-2	SMART
ZnF_C2H2	62	84	3.95e-4	SMART
ZnF_C2H2	162	185	8.09e-1	SMART
ZnF_C2H2	188	211	1.76e-1	SMART
ZnF_C2H2	236	258	3.16e-3	SMART
ZnF_C2H2	264	286	3.34e-2	SMART
ZnF_C2H2	323	345	2.63e0	SMART
ZnF_C2H2	504	526	5.72e-1	SMART
low complexity region	527	544	N/A	INTRINSIC
ZnF_C2H2	753	776	2.97e1	SMART
low complexity region	834	846	N/A	INTRINSIC
ZnF_C2H2	1092	1114	1.12e-3	SMART

Meta Mutation Damage Score

0.0897

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a zinc-finger protein, and belongs to the krueppel C2H2-type zinc-finger protein family. It may be involved in transcriptional regulation. [provided by RefSeq, Sep 2012]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,293,644	K1836E	probably benign	Het
Adora1	A	G	1: 134,203,210	F241S	probably damaging	Het
Akt1s1	C	T	7: 44,853,960	T168M	probably damaging	Het
Amigo1	C	T	3: 108,191,753		probably benign	Het
Amigo2	A	G	15: 97,245,978	F188L	possibly damaging	Het
Armc2	T	C	10: 41,993,082	T29A	possibly damaging	Het
Axl	G	A	7: 25,758,837	A822V	probably benign	Het
Borcs5	T	C	6: 134,644,329	V21A	probably benign	Het
Cdc42ep3	A	G	17: 79,334,979	S171P	probably benign	Het
Cmas	T	C	6: 142,772,285		probably benign	Het
Cyp4f40	A	G	17: 32,668,029	N158S	probably null	Het
Dnah6	G	T	6: 73,118,026	N2139K	probably benign	Het
Elmo1	A	T	13: 20,373,116	H409L	possibly damaging	Het
Exoc4	T	A	6: 33,815,687	V584E	probably damaging	Het
Gm7271	A	G	5: 76,500,533	K62R	probably damaging	Het
Gm9116	A	G	3: 93,910,479		noncoding transcript	Het
Gxylt2	A	G	6: 100,733,200	S101G	probably benign	Het
Hsph1	C	A	5: 149,636,007	E24*	probably null	Het
Ighv1-56	C	T	12: 115,242,948	E50K	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrriq1	A	T	10: 103,202,364	D859E	probably damaging	Het
Mapk7	G	A	11: 61,493,667	S71L	probably damaging	Het
Nars	A	G	18: 64,501,353	Y500H	probably damaging	Het
Olfr1165-ps	G	T	2: 88,101,485	N167K	unknown	Het
Olfr3	T	C	2: 36,812,469	M208V	probably benign	Het
Phc1	T	C	6: 122,335,007	N64S	possibly damaging	Het
Ppp4r3b	T	A	11: 29,209,450	N180K	possibly damaging	Het
Primpol	G	A	8: 46,576,183		probably benign	Het
Prtg	T	C	9: 72,842,760	S149P	possibly damaging	Het
Qrich2	T	C	11: 116,446,915	S1916G	probably damaging	Het
Rps6ka5	A	T	12: 100,597,937	Y218N	probably damaging	Het
Setbp1	T	C	18: 78,856,618	D1278G	possibly damaging	Het
Sirt1	C	T	10: 63,338,949	A8T	probably benign	Het
Sobp	C	T	10: 43,021,304	V762I	probably damaging	Het
Sptan1	T	C	2: 30,025,569	S1994P	probably damaging	Het
Taok3	T	C	5: 117,209,571	I87T	probably damaging	Het
Tecta	T	C	9: 42,366,708	Y1168C	probably damaging	Het
Trhr	A	G	15: 44,197,627	Y181C	probably damaging	Het
Ube4b	C	T	4: 149,383,798	D174N	probably damaging	Het
Ubr4	C	T	4: 139,410,440	H1067Y	possibly damaging	Het
Vmn2r86	A	G	10: 130,452,600	I344T	possibly damaging	Het
Vmn2r88	T	A	14: 51,413,289	L153*	probably null	Het
Zfp612	G	T	8: 110,089,051	V258F	possibly damaging	Het

Other mutations in Zfp516

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Zfp516	APN	18	82957108	missense	probably benign	0.08
IGL01343:Zfp516	APN	18	82993096	missense	probably damaging	0.99
IGL01413:Zfp516	APN	18	82987670	nonsense	probably null
IGL01684:Zfp516	APN	18	82957201	missense	probably damaging	1.00
IGL01820:Zfp516	APN	18	82987361	missense	probably benign	0.00
IGL02081:Zfp516	APN	18	82955733	missense	probably benign	0.00
IGL02209:Zfp516	APN	18	82994497	missense	probably benign
IGL02253:Zfp516	APN	18	82994497	missense	probably benign
IGL03028:Zfp516	APN	18	82955913	missense	possibly damaging	0.95
IGL03241:Zfp516	APN	18	82987520	missense	probably benign	0.01
R0379:Zfp516	UTSW	18	82987670	nonsense	probably null
R0426:Zfp516	UTSW	18	82955772	missense	probably benign	0.04
R0466:Zfp516	UTSW	18	82957454	splice site	probably null
R0715:Zfp516	UTSW	18	82987263	missense	probably damaging	1.00
R1574:Zfp516	UTSW	18	82993175	missense	possibly damaging	0.93
R1574:Zfp516	UTSW	18	82993175	missense	possibly damaging	0.93
R2110:Zfp516	UTSW	18	82957411	missense	probably damaging	0.99
R2112:Zfp516	UTSW	18	82957411	missense	probably damaging	0.99
R2162:Zfp516	UTSW	18	82986938	missense	possibly damaging	0.95
R2223:Zfp516	UTSW	18	82955770	missense	possibly damaging	0.94
R4097:Zfp516	UTSW	18	82987256	missense	possibly damaging	0.95
R4299:Zfp516	UTSW	18	82987497	missense	possibly damaging	0.80
R4601:Zfp516	UTSW	18	82956039	missense	probably benign	0.14
R4721:Zfp516	UTSW	18	82957111	missense	possibly damaging	0.49
R4946:Zfp516	UTSW	18	82956094	missense	probably benign	0.06
R5186:Zfp516	UTSW	18	82957093	missense	probably benign
R5351:Zfp516	UTSW	18	82956751	missense	probably benign	0.00
R5937:Zfp516	UTSW	18	82956833	missense	probably damaging	0.99
R5998:Zfp516	UTSW	18	82956514	missense	probably damaging	1.00
R6458:Zfp516	UTSW	18	82987350	missense	probably benign	0.03
R6513:Zfp516	UTSW	18	82955710	missense	probably damaging	1.00
R6626:Zfp516	UTSW	18	82988107	missense	probably damaging	1.00
R6712:Zfp516	UTSW	18	82957308	missense	probably damaging	1.00
R6877:Zfp516	UTSW	18	82955791	missense	probably damaging	1.00
R6886:Zfp516	UTSW	18	82957000	missense	probably benign	0.06
R7073:Zfp516	UTSW	18	82988200	critical splice donor site	probably null
R7463:Zfp516	UTSW	18	82957108	missense	probably benign	0.08
R7863:Zfp516	UTSW	18	83001328	missense	probably benign	0.00
R8097:Zfp516	UTSW	18	82987170	nonsense	probably null
R8244:Zfp516	UTSW	18	82956333	missense	probably damaging	1.00
R8245:Zfp516	UTSW	18	82956333	missense	probably damaging	1.00
R8362:Zfp516	UTSW	18	82986894	missense	probably benign	0.01
R8410:Zfp516	UTSW	18	82956333	missense	probably damaging	1.00
R8780:Zfp516	UTSW	18	82987955	missense	probably benign
R8791:Zfp516	UTSW	18	82957335	missense	probably damaging	1.00
R9066:Zfp516	UTSW	18	82955839	missense	probably damaging	1.00
R9556:Zfp516	UTSW	18	82956840	missense	probably benign	0.00
X0019:Zfp516	UTSW	18	82987488	missense	probably damaging	1.00
X0065:Zfp516	UTSW	18	82987169	missense	probably damaging	1.00
Z1176:Zfp516	UTSW	18	82987533	missense	probably benign	0.01
Z1177:Zfp516	UTSW	18	82956066	missense	probably damaging	1.00
Z1177:Zfp516	UTSW	18	82956067	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATGCCAGCATTTCACCCC -3'
(R):5'- GAATGCTCTTGTGGCCACTG -3'

Sequencing Primer
(F):5'- ACTACTGACCGGGTAGACTTC -3'
(R):5'- ACTGGGCTGAGTCCAAGG -3'

Posted On

2015-07-06