Incidental Mutation 'R4379:Gpr158'
ID 325224
Institutional Source Beutler Lab
Gene Symbol Gpr158
Ensembl Gene ENSMUSG00000045967
Gene Name G protein-coupled receptor 158
Synonyms 5330427M13Rik
MMRRC Submission 041677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4379 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 21367542-21830547 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 21825214 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 690 (G690V)
Ref Sequence ENSEMBL: ENSMUSP00000049708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055946]
AlphaFold Q8C419
Predicted Effect probably damaging
Transcript: ENSMUST00000055946
AA Change: G690V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: G690V

signal peptide 1 20 N/A INTRINSIC
low complexity region 110 125 N/A INTRINSIC
SCOP:d1edmb_ 313 359 5e-4 SMART
Blast:EGF 318 365 2e-27 BLAST
Pfam:7tm_3 426 669 1.2e-35 PFAM
low complexity region 840 863 N/A INTRINSIC
Meta Mutation Damage Score 0.3753 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,865,875 H1252Q probably benign Het
Adcy3 T C 12: 4,134,558 L78P probably damaging Het
Agmat G T 4: 141,757,491 A282S probably benign Het
Akap8 G T 17: 32,306,560 T515K probably damaging Het
Akap8l T C 17: 32,321,514 probably benign Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
AW209491 T C 13: 14,637,827 *422Q probably null Het
Cdan1 A G 2: 120,726,618 F576L probably damaging Het
Cers5 A G 15: 99,751,253 F45L probably damaging Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Dst A G 1: 34,227,975 I5011V probably benign Het
En1 A G 1: 120,603,355 N108S possibly damaging Het
Fam189b A T 3: 89,185,757 D274V probably damaging Het
Fancd2 T C 6: 113,561,716 S591P probably benign Het
Glt1d1 T C 5: 127,694,282 V279A possibly damaging Het
Gm10051 C T 5: 133,475,448 noncoding transcript Het
Grm7 T A 6: 111,246,374 N458K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hibadh G A 6: 52,620,042 S139L probably damaging Het
Hivep1 C T 13: 42,155,430 S382F probably damaging Het
Ift74 A G 4: 94,679,934 N403D probably benign Het
Igkv4-81 A G 6: 68,990,949 L56S probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lmbr1l G T 15: 98,909,263 C212* probably null Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrc34 A G 3: 30,631,375 L275P probably damaging Het
Mgam2-ps T C 6: 40,833,859 noncoding transcript Het
Mief1 T G 15: 80,247,959 M77R possibly damaging Het
Neurod6 T C 6: 55,679,272 T127A probably damaging Het
Nif3l1 A C 1: 58,455,579 probably benign Het
Nlrp12 T A 7: 3,239,924 T653S probably benign Het
Nol7 G T 13: 43,401,575 W228L probably damaging Het
Nrp1 G A 8: 128,468,467 R468H probably damaging Het
Olfr194 C T 16: 59,119,664 M135I probably benign Het
Olfr854 A G 9: 19,566,742 L211P probably benign Het
Pbrm1 A T 14: 31,067,706 H785L probably damaging Het
Pus7 T C 5: 23,748,866 probably benign Het
Qser1 G T 2: 104,766,059 probably null Het
Rrm1 T C 7: 102,446,593 V51A probably damaging Het
Setbp1 T C 18: 79,086,681 N112S probably damaging Het
Svil C T 18: 5,046,909 H52Y probably damaging Het
Taf1d T A 9: 15,311,981 probably benign Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Treml1 A G 17: 48,360,396 Y103C probably damaging Het
Trim28 A T 7: 13,029,480 D516V probably damaging Het
Usp34 T A 11: 23,384,499 N1164K possibly damaging Het
Vmn2r115 A G 17: 23,345,223 Y123C possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp28 C T 7: 6,393,442 T292I probably benign Het
Zmynd8 A T 2: 165,807,938 probably null Het
Zscan4d A G 7: 11,164,978 V124A probably benign Het
Other mutations in Gpr158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gpr158 APN 2 21368683 missense probably damaging 1.00
IGL00469:Gpr158 APN 2 21746795 splice site probably benign
IGL00706:Gpr158 APN 2 21746773 missense probably damaging 1.00
IGL00780:Gpr158 APN 2 21826818 nonsense probably null
IGL00885:Gpr158 APN 2 21649021 missense probably damaging 1.00
IGL01339:Gpr158 APN 2 21369031 missense possibly damaging 0.73
IGL01368:Gpr158 APN 2 21827098 missense probably damaging 1.00
IGL02141:Gpr158 APN 2 21783290 missense probably damaging 0.99
IGL02455:Gpr158 APN 2 21368700 missense probably benign 0.00
IGL02554:Gpr158 APN 2 21826596 missense probably benign
IGL02681:Gpr158 APN 2 21815630 missense probably damaging 1.00
IGL02752:Gpr158 APN 2 21826827 missense possibly damaging 0.95
IGL02756:Gpr158 APN 2 21827079 missense possibly damaging 0.47
IGL03181:Gpr158 APN 2 21783161 missense probably benign 0.02
IGL03258:Gpr158 APN 2 21825274 missense probably damaging 1.00
IGL03386:Gpr158 APN 2 21826246 missense probably damaging 1.00
PIT4810001:Gpr158 UTSW 2 21826871 missense probably benign 0.01
R0071:Gpr158 UTSW 2 21810668 missense probably benign 0.08
R0081:Gpr158 UTSW 2 21826717 missense probably damaging 1.00
R0528:Gpr158 UTSW 2 21825208 missense probably damaging 1.00
R0560:Gpr158 UTSW 2 21825274 missense probably damaging 1.00
R0603:Gpr158 UTSW 2 21815669 missense possibly damaging 0.67
R1560:Gpr158 UTSW 2 21826314 missense probably damaging 1.00
R1561:Gpr158 UTSW 2 21815694 splice site probably null
R1609:Gpr158 UTSW 2 21783293 missense possibly damaging 0.61
R1741:Gpr158 UTSW 2 21827548 missense probably benign 0.00
R1827:Gpr158 UTSW 2 21827318 missense probably benign
R1854:Gpr158 UTSW 2 21369124 missense probably damaging 1.00
R1871:Gpr158 UTSW 2 21815615 missense probably damaging 1.00
R2151:Gpr158 UTSW 2 21827514 missense possibly damaging 0.82
R2273:Gpr158 UTSW 2 21826863 missense probably benign
R2275:Gpr158 UTSW 2 21826863 missense probably benign
R3004:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R3151:Gpr158 UTSW 2 21576960 missense possibly damaging 0.68
R3943:Gpr158 UTSW 2 21368559 missense possibly damaging 0.65
R4238:Gpr158 UTSW 2 21368551 missense probably damaging 1.00
R4381:Gpr158 UTSW 2 21827592 missense probably damaging 1.00
R4464:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4467:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4496:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4506:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4530:Gpr158 UTSW 2 21369000 missense probably benign 0.03
R4646:Gpr158 UTSW 2 21827053 missense probably benign
R4798:Gpr158 UTSW 2 21783182 missense probably damaging 1.00
R4882:Gpr158 UTSW 2 21825248 missense probably damaging 0.98
R4943:Gpr158 UTSW 2 21827157 missense probably damaging 1.00
R5334:Gpr158 UTSW 2 21827505 missense probably benign 0.01
R5560:Gpr158 UTSW 2 21826290 missense possibly damaging 0.67
R5600:Gpr158 UTSW 2 21827235 missense probably benign
R5637:Gpr158 UTSW 2 21783272 missense probably benign 0.00
R5701:Gpr158 UTSW 2 21746709 missense probably damaging 1.00
R5744:Gpr158 UTSW 2 21368520 missense probably damaging 1.00
R5911:Gpr158 UTSW 2 21369121 missense possibly damaging 0.95
R5991:Gpr158 UTSW 2 21368508 missense probably damaging 0.99
R6200:Gpr158 UTSW 2 21399416 missense probably damaging 0.97
R6306:Gpr158 UTSW 2 21815611 missense possibly damaging 0.84
R6324:Gpr158 UTSW 2 21810554 missense probably damaging 1.00
R6384:Gpr158 UTSW 2 21826288 missense probably damaging 1.00
R6698:Gpr158 UTSW 2 21827110 missense probably damaging 1.00
R6997:Gpr158 UTSW 2 21648991 missense possibly damaging 0.46
R7086:Gpr158 UTSW 2 21826575 missense probably benign 0.01
R7175:Gpr158 UTSW 2 21368302 missense probably benign 0.13
R7197:Gpr158 UTSW 2 21810601 missense probably damaging 0.99
R7293:Gpr158 UTSW 2 21576939 missense possibly damaging 0.47
R7427:Gpr158 UTSW 2 21827318 missense probably benign
R7515:Gpr158 UTSW 2 21368281 missense probably damaging 1.00
R7730:Gpr158 UTSW 2 21826347 missense probably damaging 1.00
R8122:Gpr158 UTSW 2 21826863 missense probably benign
R8311:Gpr158 UTSW 2 21368890 missense probably benign 0.00
R8754:Gpr158 UTSW 2 21576882 missense probably benign 0.00
R8782:Gpr158 UTSW 2 21399338 missense probably damaging 1.00
R8792:Gpr158 UTSW 2 21553326 missense probably damaging 1.00
R8842:Gpr158 UTSW 2 21576940 missense possibly damaging 0.88
R9009:Gpr158 UTSW 2 21576949 missense probably damaging 1.00
R9102:Gpr158 UTSW 2 21825267 missense probably damaging 1.00
R9150:Gpr158 UTSW 2 21826440 missense probably benign 0.17
R9254:Gpr158 UTSW 2 21368231 start gained probably benign
R9317:Gpr158 UTSW 2 21827226 missense probably benign
R9379:Gpr158 UTSW 2 21368231 start gained probably benign
R9428:Gpr158 UTSW 2 21783161 missense probably benign
R9497:Gpr158 UTSW 2 21827014 missense probably benign 0.00
R9667:Gpr158 UTSW 2 21825243 missense probably damaging 0.99
R9681:Gpr158 UTSW 2 21826504 missense probably damaging 0.99
X0062:Gpr158 UTSW 2 21826369 missense probably damaging 1.00
Z1176:Gpr158 UTSW 2 21810690 critical splice donor site probably null
Z1177:Gpr158 UTSW 2 21827272 missense possibly damaging 0.46
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-07-06