Incidental Mutation 'R4379:Rrm1'
ID 325250
Institutional Source Beutler Lab
Gene Symbol Rrm1
Ensembl Gene ENSMUSG00000030978
Gene Name ribonucleotide reductase M1
Synonyms RnrM1
MMRRC Submission 041677-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R4379 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 102441695-102469771 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102446593 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 51 (V51A)
Ref Sequence ENSEMBL: ENSMUSP00000033283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033283] [ENSMUST00000211720]
AlphaFold P07742
Predicted Effect probably damaging
Transcript: ENSMUST00000033283
AA Change: V51A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: V51A

DomainStartEndE-ValueType
Pfam:ATP-cone 1 89 8.7e-21 PFAM
Pfam:Ribonuc_red_lgN 141 213 2.8e-25 PFAM
Pfam:Ribonuc_red_lgC 216 738 1.6e-197 PFAM
coiled coil region 749 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210751
Predicted Effect probably benign
Transcript: ENSMUST00000211720
Meta Mutation Damage Score 0.2589 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,865,875 H1252Q probably benign Het
Adcy3 T C 12: 4,134,558 L78P probably damaging Het
Agmat G T 4: 141,757,491 A282S probably benign Het
Akap8 G T 17: 32,306,560 T515K probably damaging Het
Akap8l T C 17: 32,321,514 probably benign Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
AW209491 T C 13: 14,637,827 *422Q probably null Het
Cdan1 A G 2: 120,726,618 F576L probably damaging Het
Cers5 A G 15: 99,751,253 F45L probably damaging Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Dst A G 1: 34,227,975 I5011V probably benign Het
En1 A G 1: 120,603,355 N108S possibly damaging Het
Fam189b A T 3: 89,185,757 D274V probably damaging Het
Fancd2 T C 6: 113,561,716 S591P probably benign Het
Glt1d1 T C 5: 127,694,282 V279A possibly damaging Het
Gm10051 C T 5: 133,475,448 noncoding transcript Het
Gpr158 G T 2: 21,825,214 G690V probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Grm7 T A 6: 111,246,374 N458K probably benign Het
Hibadh G A 6: 52,620,042 S139L probably damaging Het
Hivep1 C T 13: 42,155,430 S382F probably damaging Het
Ift74 A G 4: 94,679,934 N403D probably benign Het
Igkv4-81 A G 6: 68,990,949 L56S probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lmbr1l G T 15: 98,909,263 C212* probably null Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrc34 A G 3: 30,631,375 L275P probably damaging Het
Mgam2-ps T C 6: 40,833,859 noncoding transcript Het
Mief1 T G 15: 80,247,959 M77R possibly damaging Het
Neurod6 T C 6: 55,679,272 T127A probably damaging Het
Nif3l1 A C 1: 58,455,579 probably benign Het
Nlrp12 T A 7: 3,239,924 T653S probably benign Het
Nol7 G T 13: 43,401,575 W228L probably damaging Het
Nrp1 G A 8: 128,468,467 R468H probably damaging Het
Olfr194 C T 16: 59,119,664 M135I probably benign Het
Olfr854 A G 9: 19,566,742 L211P probably benign Het
Pbrm1 A T 14: 31,067,706 H785L probably damaging Het
Pus7 T C 5: 23,748,866 probably benign Het
Qser1 G T 2: 104,766,059 probably null Het
Setbp1 T C 18: 79,086,681 N112S probably damaging Het
Svil C T 18: 5,046,909 H52Y probably damaging Het
Taf1d T A 9: 15,311,981 probably benign Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Treml1 A G 17: 48,360,396 Y103C probably damaging Het
Trim28 A T 7: 13,029,480 D516V probably damaging Het
Usp34 T A 11: 23,384,499 N1164K possibly damaging Het
Vmn2r115 A G 17: 23,345,223 Y123C possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp28 C T 7: 6,393,442 T292I probably benign Het
Zmynd8 A T 2: 165,807,938 probably null Het
Zscan4d A G 7: 11,164,978 V124A probably benign Het
Other mutations in Rrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rrm1 APN 7 102454507 nonsense probably null
IGL01431:Rrm1 APN 7 102457552 splice site probably benign
IGL03251:Rrm1 APN 7 102457206 missense probably damaging 1.00
IGL03401:Rrm1 APN 7 102465744 missense possibly damaging 0.81
Arabica UTSW 7 102460351 missense probably damaging 1.00
Pentose UTSW 7 102460856 splice site probably null
R0454:Rrm1 UTSW 7 102466926 missense probably damaging 1.00
R0548:Rrm1 UTSW 7 102467067 critical splice donor site probably null
R0759:Rrm1 UTSW 7 102457561 missense probably benign 0.32
R1575:Rrm1 UTSW 7 102456514 missense probably damaging 1.00
R1586:Rrm1 UTSW 7 102466905 makesense probably null
R1625:Rrm1 UTSW 7 102468347 missense probably damaging 0.98
R2207:Rrm1 UTSW 7 102442026 start codon destroyed probably null 0.98
R2432:Rrm1 UTSW 7 102443072 missense probably benign 0.03
R2513:Rrm1 UTSW 7 102460689 missense probably damaging 0.99
R3796:Rrm1 UTSW 7 102465703 splice site probably null
R3914:Rrm1 UTSW 7 102457174 missense probably damaging 1.00
R4179:Rrm1 UTSW 7 102457198 missense probably damaging 1.00
R4302:Rrm1 UTSW 7 102447824 missense probably benign 0.00
R4416:Rrm1 UTSW 7 102447801 missense probably benign 0.06
R4690:Rrm1 UTSW 7 102447879 missense probably benign
R4939:Rrm1 UTSW 7 102466924 missense probably benign 0.34
R5433:Rrm1 UTSW 7 102465767 missense probably damaging 0.97
R5445:Rrm1 UTSW 7 102451023 missense possibly damaging 0.77
R6120:Rrm1 UTSW 7 102460856 splice site probably null
R6198:Rrm1 UTSW 7 102446729 critical splice donor site probably null
R6369:Rrm1 UTSW 7 102446702 missense probably damaging 0.97
R6699:Rrm1 UTSW 7 102460825 missense probably damaging 1.00
R7009:Rrm1 UTSW 7 102460334 missense probably damaging 1.00
R7491:Rrm1 UTSW 7 102454557 missense probably damaging 1.00
R8024:Rrm1 UTSW 7 102457265 missense probably benign 0.00
R8276:Rrm1 UTSW 7 102460852 critical splice donor site probably null
R8713:Rrm1 UTSW 7 102460351 missense probably damaging 1.00
R8963:Rrm1 UTSW 7 102456532 missense probably benign 0.23
R8968:Rrm1 UTSW 7 102468338 missense probably benign 0.03
R9028:Rrm1 UTSW 7 102460398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACCCACACAGTGTATGGTAG -3'
(R):5'- TGACACTATTAAACGCTTTCTCATG -3'

Sequencing Primer
(F):5'- ACTCCAGTTTCAGGGAATCTG -3'
(R):5'- GTTTTTATACCAGACGTACCACTG -3'
Posted On 2015-07-06