Incidental Mutation 'R4379:Nrp1'
ID325251
Institutional Source Beutler Lab
Gene Symbol Nrp1
Ensembl Gene ENSMUSG00000025810
Gene Nameneuropilin 1
SynonymsNeuropilin-1, NP-1, NPN-1, Npn1
MMRRC Submission 041677-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4379 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location128358604-128503363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128468467 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 468 (R468H)
Ref Sequence ENSEMBL: ENSMUSP00000026917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026917]
PDB Structure
Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000026917
AA Change: R468H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810
AA Change: R468H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CUB 27 141 1.44e-43 SMART
CUB 147 265 9.19e-42 SMART
FA58C 274 424 5.21e-44 SMART
FA58C 430 583 4.15e-20 SMART
low complexity region 587 599 N/A INTRINSIC
MAM 645 811 4.94e-69 SMART
Pfam:DUF3481 837 920 3.5e-31 PFAM
Meta Mutation Damage Score 0.4713 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,865,875 H1252Q probably benign Het
Adcy3 T C 12: 4,134,558 L78P probably damaging Het
Agmat G T 4: 141,757,491 A282S probably benign Het
Akap8 G T 17: 32,306,560 T515K probably damaging Het
Akap8l T C 17: 32,321,514 probably benign Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
AW209491 T C 13: 14,637,827 *422Q probably null Het
Cdan1 A G 2: 120,726,618 F576L probably damaging Het
Cers5 A G 15: 99,751,253 F45L probably damaging Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Dst A G 1: 34,227,975 I5011V probably benign Het
En1 A G 1: 120,603,355 N108S possibly damaging Het
Fam189b A T 3: 89,185,757 D274V probably damaging Het
Fancd2 T C 6: 113,561,716 S591P probably benign Het
Glt1d1 T C 5: 127,694,282 V279A possibly damaging Het
Gm10051 C T 5: 133,475,448 noncoding transcript Het
Gpr158 G T 2: 21,825,214 G690V probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Grm7 T A 6: 111,246,374 N458K probably benign Het
Hibadh G A 6: 52,620,042 S139L probably damaging Het
Hivep1 C T 13: 42,155,430 S382F probably damaging Het
Ift74 A G 4: 94,679,934 N403D probably benign Het
Igkv4-81 A G 6: 68,990,949 L56S probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lmbr1l G T 15: 98,909,263 C212* probably null Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrc34 A G 3: 30,631,375 L275P probably damaging Het
Mgam2-ps T C 6: 40,833,859 noncoding transcript Het
Mief1 T G 15: 80,247,959 M77R possibly damaging Het
Neurod6 T C 6: 55,679,272 T127A probably damaging Het
Nif3l1 A C 1: 58,455,579 probably benign Het
Nlrp12 T A 7: 3,239,924 T653S probably benign Het
Nol7 G T 13: 43,401,575 W228L probably damaging Het
Olfr194 C T 16: 59,119,664 M135I probably benign Het
Olfr854 A G 9: 19,566,742 L211P probably benign Het
Pbrm1 A T 14: 31,067,706 H785L probably damaging Het
Pus7 T C 5: 23,748,866 probably benign Het
Qser1 G T 2: 104,766,059 probably null Het
Rrm1 T C 7: 102,446,593 V51A probably damaging Het
Setbp1 T C 18: 79,086,681 N112S probably damaging Het
Svil C T 18: 5,046,909 H52Y probably damaging Het
Taf1d T A 9: 15,311,981 probably benign Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Treml1 A G 17: 48,360,396 Y103C probably damaging Het
Trim28 A T 7: 13,029,480 D516V probably damaging Het
Usp34 T A 11: 23,384,499 N1164K possibly damaging Het
Vmn2r115 A G 17: 23,345,223 Y123C possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp28 C T 7: 6,393,442 T292I probably benign Het
Zmynd8 A T 2: 165,807,938 probably null Het
Zscan4d A G 7: 11,164,978 V124A probably benign Het
Other mutations in Nrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrp1 APN 8 128476207 missense probably benign
IGL01412:Nrp1 APN 8 128418707 splice site probably benign
IGL01586:Nrp1 APN 8 128432032 missense possibly damaging 0.86
IGL02307:Nrp1 APN 8 128502720 missense probably damaging 1.00
IGL02500:Nrp1 APN 8 128425799 missense possibly damaging 0.94
IGL02547:Nrp1 APN 8 128493031 missense probably benign
R0046:Nrp1 UTSW 8 128500608 splice site probably benign
R0281:Nrp1 UTSW 8 128460683 missense probably damaging 0.96
R0403:Nrp1 UTSW 8 128457969 missense probably damaging 1.00
R0610:Nrp1 UTSW 8 128502618 missense probably damaging 1.00
R1055:Nrp1 UTSW 8 128468598 missense possibly damaging 0.68
R1229:Nrp1 UTSW 8 128418716 nonsense probably null
R1263:Nrp1 UTSW 8 128468389 missense probably damaging 1.00
R1340:Nrp1 UTSW 8 128434355 missense probably damaging 1.00
R1397:Nrp1 UTSW 8 128418716 nonsense probably null
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1531:Nrp1 UTSW 8 128425969 missense probably null 0.19
R1587:Nrp1 UTSW 8 128476282 missense probably damaging 1.00
R1719:Nrp1 UTSW 8 128425885 missense probably damaging 1.00
R1733:Nrp1 UTSW 8 128468493 missense probably benign 0.02
R1785:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R1786:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2047:Nrp1 UTSW 8 128498096 splice site probably benign
R2130:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2132:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2133:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2163:Nrp1 UTSW 8 128497871 missense probably damaging 1.00
R2338:Nrp1 UTSW 8 128497904 missense probably benign 0.01
R2407:Nrp1 UTSW 8 128431945 missense probably damaging 0.99
R3405:Nrp1 UTSW 8 128498088 nonsense probably null
R3748:Nrp1 UTSW 8 128457980 missense probably damaging 1.00
R4347:Nrp1 UTSW 8 128480991 critical splice donor site probably null
R4646:Nrp1 UTSW 8 128457944 missense probably benign 0.00
R4688:Nrp1 UTSW 8 128502566 missense probably benign 0.01
R4916:Nrp1 UTSW 8 128502804 nonsense probably null
R5077:Nrp1 UTSW 8 128500673 critical splice donor site probably null
R5301:Nrp1 UTSW 8 128434197 splice site probably null
R5509:Nrp1 UTSW 8 128425915 missense possibly damaging 0.73
R5745:Nrp1 UTSW 8 128468448 missense probably benign 0.22
R5873:Nrp1 UTSW 8 128468377 missense probably damaging 1.00
R5987:Nrp1 UTSW 8 128476169 missense probably damaging 1.00
R6060:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
R6757:Nrp1 UTSW 8 128425868 missense probably damaging 1.00
R6889:Nrp1 UTSW 8 128493057 missense probably damaging 1.00
R7025:Nrp1 UTSW 8 128480954 missense probably damaging 1.00
R7065:Nrp1 UTSW 8 128460712 missense probably benign
R7290:Nrp1 UTSW 8 128476296 critical splice donor site probably null
R7369:Nrp1 UTSW 8 128431915 missense probably damaging 1.00
R7553:Nrp1 UTSW 8 128431987 missense probably damaging 1.00
R7650:Nrp1 UTSW 8 128498014 missense possibly damaging 0.87
R8043:Nrp1 UTSW 8 128432023 missense probably benign 0.00
X0066:Nrp1 UTSW 8 128460645 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAAGGTGTCTCTGAGAAAATAACC -3'
(R):5'- TACCTCAGGGCCTTACCTTAGC -3'

Sequencing Primer
(F):5'- GAAAATAACCTCAGCCCATCTGTTTC -3'
(R):5'- CCATGATAGTTTTCCAGTCAGAGC -3'
Posted On2015-07-06