Incidental Mutation 'R4379:Igsf9b'
ID325254
Institutional Source Beutler Lab
Gene Symbol Igsf9b
Ensembl Gene ENSMUSG00000034275
Gene Nameimmunoglobulin superfamily, member 9B
SynonymsLOC235086
MMRRC Submission 041677-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R4379 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location27299204-27357546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27309478 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 47 (V47I)
Ref Sequence ENSEMBL: ENSMUSP00000117017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115247
AA Change: V47I

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: V47I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133213
AA Change: V47I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: V47I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 835 843 N/A INTRINSIC
low complexity region 971 982 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1148 1161 N/A INTRINSIC
low complexity region 1172 1190 N/A INTRINSIC
low complexity region 1246 1273 N/A INTRINSIC
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1313 1326 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214357
AA Change: V47I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,865,875 H1252Q probably benign Het
Adcy3 T C 12: 4,134,558 L78P probably damaging Het
Agmat G T 4: 141,757,491 A282S probably benign Het
Akap8 G T 17: 32,306,560 T515K probably damaging Het
Akap8l T C 17: 32,321,514 probably benign Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
AW209491 T C 13: 14,637,827 *422Q probably null Het
Cdan1 A G 2: 120,726,618 F576L probably damaging Het
Cers5 A G 15: 99,751,253 F45L probably damaging Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Dst A G 1: 34,227,975 I5011V probably benign Het
En1 A G 1: 120,603,355 N108S possibly damaging Het
Fam189b A T 3: 89,185,757 D274V probably damaging Het
Fancd2 T C 6: 113,561,716 S591P probably benign Het
Glt1d1 T C 5: 127,694,282 V279A possibly damaging Het
Gm10051 C T 5: 133,475,448 noncoding transcript Het
Gpr158 G T 2: 21,825,214 G690V probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Grm7 T A 6: 111,246,374 N458K probably benign Het
Hibadh G A 6: 52,620,042 S139L probably damaging Het
Hivep1 C T 13: 42,155,430 S382F probably damaging Het
Ift74 A G 4: 94,679,934 N403D probably benign Het
Igkv4-81 A G 6: 68,990,949 L56S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lmbr1l G T 15: 98,909,263 C212* probably null Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrc34 A G 3: 30,631,375 L275P probably damaging Het
Mgam2-ps T C 6: 40,833,859 noncoding transcript Het
Mief1 T G 15: 80,247,959 M77R possibly damaging Het
Neurod6 T C 6: 55,679,272 T127A probably damaging Het
Nif3l1 A C 1: 58,455,579 probably benign Het
Nlrp12 T A 7: 3,239,924 T653S probably benign Het
Nol7 G T 13: 43,401,575 W228L probably damaging Het
Nrp1 G A 8: 128,468,467 R468H probably damaging Het
Olfr194 C T 16: 59,119,664 M135I probably benign Het
Olfr854 A G 9: 19,566,742 L211P probably benign Het
Pbrm1 A T 14: 31,067,706 H785L probably damaging Het
Pus7 T C 5: 23,748,866 probably benign Het
Qser1 G T 2: 104,766,059 probably null Het
Rrm1 T C 7: 102,446,593 V51A probably damaging Het
Setbp1 T C 18: 79,086,681 N112S probably damaging Het
Svil C T 18: 5,046,909 H52Y probably damaging Het
Taf1d T A 9: 15,311,981 probably benign Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Treml1 A G 17: 48,360,396 Y103C probably damaging Het
Trim28 A T 7: 13,029,480 D516V probably damaging Het
Usp34 T A 11: 23,384,499 N1164K possibly damaging Het
Vmn2r115 A G 17: 23,345,223 Y123C possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp28 C T 7: 6,393,442 T292I probably benign Het
Zmynd8 A T 2: 165,807,938 probably null Het
Zscan4d A G 7: 11,164,978 V124A probably benign Het
Other mutations in Igsf9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Igsf9b APN 9 27319655 missense probably damaging 1.00
IGL01013:Igsf9b APN 9 27334304 missense probably damaging 1.00
IGL01960:Igsf9b APN 9 27328606 missense possibly damaging 0.93
IGL02398:Igsf9b APN 9 27333130 missense possibly damaging 0.54
IGL03007:Igsf9b APN 9 27333082 missense probably damaging 0.98
IGL03014:Igsf9b UTSW 9 27322636 missense probably benign 0.00
R0127:Igsf9b UTSW 9 27334385 missense possibly damaging 0.65
R0376:Igsf9b UTSW 9 27334582 missense probably benign 0.01
R0520:Igsf9b UTSW 9 27323250 missense probably benign 0.00
R0534:Igsf9b UTSW 9 27333062 intron probably null
R0613:Igsf9b UTSW 9 27326920 missense probably damaging 1.00
R0718:Igsf9b UTSW 9 27323361 critical splice donor site probably null
R0828:Igsf9b UTSW 9 27319605 nonsense probably null
R0879:Igsf9b UTSW 9 27333742 missense probably damaging 1.00
R0882:Igsf9b UTSW 9 27319316 missense probably damaging 0.98
R0987:Igsf9b UTSW 9 27332553 splice site probably null
R1162:Igsf9b UTSW 9 27326889 missense probably benign
R1758:Igsf9b UTSW 9 27334252 missense possibly damaging 0.50
R1760:Igsf9b UTSW 9 27317827 missense possibly damaging 0.82
R1819:Igsf9b UTSW 9 27311593 missense probably damaging 0.98
R1823:Igsf9b UTSW 9 27331732 missense probably damaging 0.96
R1982:Igsf9b UTSW 9 27322239 missense possibly damaging 0.82
R2150:Igsf9b UTSW 9 27334337 missense probably damaging 1.00
R2228:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2229:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2250:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R2872:Igsf9b UTSW 9 27322223 missense probably benign 0.11
R2872:Igsf9b UTSW 9 27322223 missense probably benign 0.11
R3415:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3416:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3417:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3427:Igsf9b UTSW 9 27334577 missense probably damaging 0.99
R4356:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4357:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4358:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4359:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4416:Igsf9b UTSW 9 27322917 missense probably damaging 1.00
R4445:Igsf9b UTSW 9 27334252 missense probably benign 0.13
R4446:Igsf9b UTSW 9 27334252 missense probably benign 0.13
R4787:Igsf9b UTSW 9 27317456 missense probably benign 0.26
R4887:Igsf9b UTSW 9 27322650 missense probably benign 0.45
R5085:Igsf9b UTSW 9 27317437 missense probably benign 0.03
R5360:Igsf9b UTSW 9 27311672 missense probably damaging 0.98
R5417:Igsf9b UTSW 9 27334276 small insertion probably benign
R5686:Igsf9b UTSW 9 27324179 missense probably damaging 0.99
R5738:Igsf9b UTSW 9 27328530 missense probably damaging 0.98
R5869:Igsf9b UTSW 9 27323235 missense probably benign 0.44
R6304:Igsf9b UTSW 9 27342575 missense probably benign 0.19
R6359:Igsf9b UTSW 9 27309599 missense probably benign 0.25
R6367:Igsf9b UTSW 9 27309525 nonsense probably null
R6556:Igsf9b UTSW 9 27329555 missense probably damaging 1.00
R7058:Igsf9b UTSW 9 27322854 missense probably damaging 0.99
R7165:Igsf9b UTSW 9 27334240 missense probably benign
R7180:Igsf9b UTSW 9 27322668 missense possibly damaging 0.95
R7212:Igsf9b UTSW 9 27331696 missense probably damaging 0.98
R7461:Igsf9b UTSW 9 27334122 missense probably benign 0.10
R7605:Igsf9b UTSW 9 27323312 missense probably damaging 0.98
R7609:Igsf9b UTSW 9 27345890 missense probably benign
R7613:Igsf9b UTSW 9 27334122 missense probably benign 0.10
X0013:Igsf9b UTSW 9 27331725 missense possibly damaging 0.89
X0025:Igsf9b UTSW 9 27309461 missense probably damaging 1.00
X0028:Igsf9b UTSW 9 27334372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAAGAGATGGGTGTCCTGG -3'
(R):5'- ACACAGTCAAAACCTGGGG -3'

Sequencing Primer
(F):5'- GTCCTGGGTGTACTAGGGAC -3'
(R):5'- TACTCAGGGTCCACATGT -3'
Posted On2015-07-06