Mutagenetix > Incidental Mutations

Incidental Mutation 'R4379:Igsf9b'

325254

Institutional Source

Beutler Lab

Gene Symbol

Igsf9b

Ensembl Gene

ENSMUSG00000034275

Gene Name

immunoglobulin superfamily, member 9B

Synonyms

LOC235086

MMRRC Submission

041677-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.548) question?

Stock #

R4379 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27299204-27357546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 27309478 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 47 (V47I)

Ref Sequence

ENSEMBL: ENSMUSP00000117017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115247
AA Change: V47I

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: V47I

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133213
AA Change: V47I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: V47I

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART
transmembrane domain	727	749	N/A	INTRINSIC
low complexity region	750	760	N/A	INTRINSIC
low complexity region	835	843	N/A	INTRINSIC
low complexity region	971	982	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1148	1161	N/A	INTRINSIC
low complexity region	1172	1190	N/A	INTRINSIC
low complexity region	1246	1273	N/A	INTRINSIC
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1313	1326	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214357
AA Change: V47I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

95% (53/56)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	C	A	5: 8,865,875	H1252Q	probably benign	Het
Adcy3	T	C	12: 4,134,558	L78P	probably damaging	Het
Agmat	G	T	4: 141,757,491	A282S	probably benign	Het
Akap8	G	T	17: 32,306,560	T515K	probably damaging	Het
Akap8l	T	C	17: 32,321,514		probably benign	Het
Alpk1	C	T	3: 127,729,373	V7M	probably damaging	Het
AW209491	T	C	13: 14,637,827	*422Q	probably null	Het
Cdan1	A	G	2: 120,726,618	F576L	probably damaging	Het
Cers5	A	G	15: 99,751,253	F45L	probably damaging	Het
Dst	A	G	1: 34,227,975	I5011V	probably benign	Het
Dst	T	C	1: 34,163,235	S215P	probably damaging	Het
En1	A	G	1: 120,603,355	N108S	possibly damaging	Het
Fam189b	A	T	3: 89,185,757	D274V	probably damaging	Het
Fancd2	T	C	6: 113,561,716	S591P	probably benign	Het
Glt1d1	T	C	5: 127,694,282	V279A	possibly damaging	Het
Gm10051	C	T	5: 133,475,448		noncoding transcript	Het
Gpr158	G	T	2: 21,825,214	G690V	probably damaging	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Grm7	T	A	6: 111,246,374	N458K	probably benign	Het
Hibadh	G	A	6: 52,620,042	S139L	probably damaging	Het
Hivep1	C	T	13: 42,155,430	S382F	probably damaging	Het
Ift74	A	G	4: 94,679,934	N403D	probably benign	Het
Igkv4-81	A	G	6: 68,990,949	L56S	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lmbr1l	G	T	15: 98,909,263	C212*	probably null	Het
Lrp10	C	T	14: 54,468,366	R338C	probably damaging	Het
Lrrc34	A	G	3: 30,631,375	L275P	probably damaging	Het
Mgam2-ps	T	C	6: 40,833,859		noncoding transcript	Het
Mief1	T	G	15: 80,247,959	M77R	possibly damaging	Het
Neurod6	T	C	6: 55,679,272	T127A	probably damaging	Het
Nif3l1	A	C	1: 58,455,579		probably benign	Het
Nlrp12	T	A	7: 3,239,924	T653S	probably benign	Het
Nol7	G	T	13: 43,401,575	W228L	probably damaging	Het
Nrp1	G	A	8: 128,468,467	R468H	probably damaging	Het
Olfr194	C	T	16: 59,119,664	M135I	probably benign	Het
Olfr854	A	G	9: 19,566,742	L211P	probably benign	Het
Pbrm1	A	T	14: 31,067,706	H785L	probably damaging	Het
Pus7	T	C	5: 23,748,866		probably benign	Het
Qser1	G	T	2: 104,766,059		probably null	Het
Rrm1	T	C	7: 102,446,593	V51A	probably damaging	Het
Setbp1	T	C	18: 79,086,681	N112S	probably damaging	Het
Svil	C	T	18: 5,046,909	H52Y	probably damaging	Het
Taf1d	T	A	9: 15,311,981		probably benign	Het
Tle1	ACAGGTTTCTTCAGGTTTCTT	ACAGGTTTCTT	4: 72,118,163		probably benign	Het
Treml1	A	G	17: 48,360,396	Y103C	probably damaging	Het
Trim28	A	T	7: 13,029,480	D516V	probably damaging	Het
Usp34	T	A	11: 23,384,499	N1164K	possibly damaging	Het
Vmn2r115	A	G	17: 23,345,223	Y123C	possibly damaging	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Zfp28	C	T	7: 6,393,442	T292I	probably benign	Het
Zmynd8	A	T	2: 165,807,938		probably null	Het
Zscan4d	A	G	7: 11,164,978	V124A	probably benign	Het

Other mutations in Igsf9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Igsf9b	APN	9	27319655	missense	probably damaging	1.00
IGL01013:Igsf9b	APN	9	27334304	missense	probably damaging	1.00
IGL01960:Igsf9b	APN	9	27328606	missense	possibly damaging	0.93
IGL02398:Igsf9b	APN	9	27333130	missense	possibly damaging	0.54
IGL03007:Igsf9b	APN	9	27333082	missense	probably damaging	0.98
IGL03014:Igsf9b	UTSW	9	27322636	missense	probably benign	0.00
R0127:Igsf9b	UTSW	9	27334385	missense	possibly damaging	0.65
R0376:Igsf9b	UTSW	9	27334582	missense	probably benign	0.01
R0520:Igsf9b	UTSW	9	27323250	missense	probably benign	0.00
R0534:Igsf9b	UTSW	9	27333062	splice site	probably null
R0613:Igsf9b	UTSW	9	27326920	missense	probably damaging	1.00
R0718:Igsf9b	UTSW	9	27323361	critical splice donor site	probably null
R0828:Igsf9b	UTSW	9	27319605	nonsense	probably null
R0879:Igsf9b	UTSW	9	27333742	missense	probably damaging	1.00
R0882:Igsf9b	UTSW	9	27319316	missense	probably damaging	0.98
R0987:Igsf9b	UTSW	9	27332553	splice site	probably null
R1162:Igsf9b	UTSW	9	27326889	missense	probably benign
R1758:Igsf9b	UTSW	9	27334252	missense	possibly damaging	0.50
R1760:Igsf9b	UTSW	9	27317827	missense	possibly damaging	0.82
R1819:Igsf9b	UTSW	9	27311593	missense	probably damaging	0.98
R1823:Igsf9b	UTSW	9	27331732	missense	probably damaging	0.96
R1982:Igsf9b	UTSW	9	27322239	missense	possibly damaging	0.82
R2150:Igsf9b	UTSW	9	27334337	missense	probably damaging	1.00
R2228:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2229:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2250:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R3415:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3416:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3417:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3427:Igsf9b	UTSW	9	27334577	missense	probably damaging	0.99
R4356:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4357:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4358:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4359:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4416:Igsf9b	UTSW	9	27322917	missense	probably damaging	1.00
R4445:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4446:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4787:Igsf9b	UTSW	9	27317456	missense	probably benign	0.26
R4887:Igsf9b	UTSW	9	27322650	missense	probably benign	0.45
R5085:Igsf9b	UTSW	9	27317437	missense	probably benign	0.03
R5360:Igsf9b	UTSW	9	27311672	missense	probably damaging	0.98
R5417:Igsf9b	UTSW	9	27334276	small insertion	probably benign
R5686:Igsf9b	UTSW	9	27324179	missense	probably damaging	0.99
R5738:Igsf9b	UTSW	9	27328530	missense	probably damaging	0.98
R5869:Igsf9b	UTSW	9	27323235	missense	probably benign	0.44
R6304:Igsf9b	UTSW	9	27342575	missense	probably benign	0.19
R6359:Igsf9b	UTSW	9	27309599	missense	probably benign	0.25
R6367:Igsf9b	UTSW	9	27309525	nonsense	probably null
R6556:Igsf9b	UTSW	9	27329555	missense	probably damaging	1.00
R7058:Igsf9b	UTSW	9	27322854	missense	probably damaging	0.99
R7165:Igsf9b	UTSW	9	27334240	missense	probably benign
R7180:Igsf9b	UTSW	9	27322668	missense	possibly damaging	0.95
R7212:Igsf9b	UTSW	9	27331696	missense	probably damaging	0.98
R7461:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R7605:Igsf9b	UTSW	9	27323312	missense	probably damaging	0.98
R7609:Igsf9b	UTSW	9	27345890	missense	probably benign
R7613:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R8072:Igsf9b	UTSW	9	27317364	missense	possibly damaging	0.94
R8163:Igsf9b	UTSW	9	27322611	splice site	probably null
X0013:Igsf9b	UTSW	9	27331725	missense	possibly damaging	0.89
X0025:Igsf9b	UTSW	9	27309461	missense	probably damaging	1.00
X0028:Igsf9b	UTSW	9	27334372	missense	probably damaging	1.00
Z1176:Igsf9b	UTSW	9	27317353	critical splice acceptor site	probably null
Z1177:Igsf9b	UTSW	9	27334292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATAAGAGATGGGTGTCCTGG -3'
(R):5'- ACACAGTCAAAACCTGGGG -3'

Sequencing Primer
(F):5'- GTCCTGGGTGTACTAGGGAC -3'
(R):5'- TACTCAGGGTCCACATGT -3'

Posted On

2015-07-06