Incidental Mutation 'R0012:Olfr1318'
ID32527
Institutional Source Beutler Lab
Gene Symbol Olfr1318
Ensembl Gene ENSMUSG00000049758
Gene Nameolfactory receptor 1318
SynonymsMOR245-16, GA_x6K02T2Q125-73202172-73203134
MMRRC Submission 038307-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0012 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112154198-112159157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112156826 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 292 (N292Y)
Ref Sequence ENSEMBL: ENSMUSP00000151164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058176] [ENSMUST00000214063] [ENSMUST00000217533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058176
AA Change: N292Y

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051938
Gene: ENSMUSG00000049758
AA Change: N292Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 2.4e-39 PFAM
Pfam:7tm_1 41 287 1.5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214063
AA Change: N292Y

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216873
Predicted Effect possibly damaging
Transcript: ENSMUST00000217533
AA Change: N292Y

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 A T 2: 131,052,920 L687Q probably damaging Het
Adap1 A G 5: 139,307,734 probably benign Het
Add2 T A 6: 86,098,628 V253E probably damaging Het
Agtr1a A T 13: 30,381,749 I266F probably damaging Het
Anxa9 A G 3: 95,308,095 probably benign Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Asna1 T C 8: 85,025,096 probably benign Het
Bnip3 A G 7: 138,898,672 probably benign Het
Brwd1 A C 16: 96,059,652 S311R probably damaging Het
C2cd3 G A 7: 100,418,522 V871M possibly damaging Het
Cacul1 A G 19: 60,564,253 W145R probably damaging Het
Celf5 C A 10: 81,469,512 V141L probably damaging Het
Cfap206 C A 4: 34,714,519 L392F possibly damaging Het
Chd2 G T 7: 73,455,519 T192K probably damaging Het
Chrna10 T C 7: 102,115,057 N40S possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clspn T A 4: 126,564,929 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col5a3 A T 9: 20,777,108 probably benign Het
Copb1 T A 7: 114,237,408 K366N probably damaging Het
Cul9 G A 17: 46,538,510 R570C probably benign Het
Cyp2c70 A T 19: 40,187,243 L7Q probably null Het
Dock2 T C 11: 34,783,795 E10G possibly damaging Het
Dpysl4 T G 7: 139,097,883 I412S probably benign Het
Eaf2 T A 16: 36,808,174 probably benign Het
Fasl T C 1: 161,788,164 D41G probably benign Het
Fat2 A G 11: 55,262,871 V3505A probably benign Het
Fbxo24 A G 5: 137,621,994 F101S probably damaging Het
Fdft1 T C 14: 63,177,698 I28M probably benign Het
Gcnt3 T C 9: 70,034,085 I400M probably benign Het
Gpd2 T A 2: 57,338,868 M228K probably damaging Het
Gsap T A 5: 21,226,229 probably benign Het
Hipk1 A G 3: 103,763,680 M467T probably damaging Het
Hmgb4 T A 4: 128,260,725 I17F probably damaging Het
Ints10 C A 8: 68,807,475 L284M probably benign Het
Kif17 T G 4: 138,293,748 S606A probably damaging Het
Lifr C A 15: 7,175,608 T442K possibly damaging Het
Lypd4 A G 7: 24,865,332 L127P probably damaging Het
Lyst A G 13: 13,687,694 H2605R probably benign Het
Map3k4 A G 17: 12,238,189 S1289P probably damaging Het
Mgam T A 6: 40,765,256 probably null Het
Mob1b G A 5: 88,756,084 probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Ms4a4c C A 19: 11,418,980 probably benign Het
Mthfd2l A T 5: 90,961,383 H224L probably damaging Het
Myh8 T C 11: 67,300,021 Y1350H probably benign Het
Nectin2 T C 7: 19,730,744 probably benign Het
Nos1 A C 5: 117,893,902 N305T probably damaging Het
Ogfrl1 T A 1: 23,370,125 Q340L possibly damaging Het
Olfr1502 C A 19: 13,861,823 T10K probably damaging Het
Olfr170 T C 16: 19,606,440 N76S probably benign Het
Olfr427 T G 1: 174,100,207 F250V probably damaging Het
Orc1 T C 4: 108,595,646 probably null Het
Plekhg5 C A 4: 152,104,750 D249E probably benign Het
Plet1 A G 9: 50,499,130 I74V probably benign Het
Psmd2 T A 16: 20,661,684 D718E probably damaging Het
Rab33b G T 3: 51,484,316 probably benign Het
Rae1 T A 2: 173,002,673 F4I unknown Het
Ralgapa2 A G 2: 146,412,752 Y821H probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sharpin G T 15: 76,348,343 P156T possibly damaging Het
Slc38a4 C T 15: 96,999,629 R435H probably damaging Het
Snrnp200 T C 2: 127,228,549 V1061A probably benign Het
Suclg1 A G 6: 73,270,997 T234A possibly damaging Het
Swsap1 T C 9: 21,957,022 C197R probably benign Het
Tbx15 A G 3: 99,352,096 T428A probably benign Het
Tet2 T C 3: 133,476,558 Y1215C probably damaging Het
Tjp1 A G 7: 65,329,775 probably benign Het
Tmem209 G T 6: 30,502,113 probably benign Het
Tnpo3 T C 6: 29,589,177 E58G probably damaging Het
Trp53bp2 T A 1: 182,444,718 M464K probably damaging Het
Ttc32 A G 12: 9,035,897 Y148C possibly damaging Het
Unc80 T C 1: 66,507,391 S541P probably damaging Het
Ushbp1 T C 8: 71,395,040 probably benign Het
Vmn2r100 A G 17: 19,504,874 M22V probably benign Het
Vmn2r100 A T 17: 19,526,034 E485V probably damaging Het
Wdr24 G A 17: 25,827,113 V471I probably benign Het
Zfp35 T A 18: 24,002,944 M115K probably benign Het
Zfp429 G A 13: 67,390,677 S216L probably benign Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Olfr1318
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr1318 APN 2 112156067 missense probably benign
IGL00923:Olfr1318 APN 2 112156777 missense possibly damaging 0.75
IGL02800:Olfr1318 APN 2 112156244 missense possibly damaging 0.95
R1614:Olfr1318 UTSW 2 112156517 missense probably damaging 1.00
R1989:Olfr1318 UTSW 2 112156377 missense probably benign 0.00
R2428:Olfr1318 UTSW 2 112156442 missense probably benign 0.03
R2963:Olfr1318 UTSW 2 112156459 nonsense probably null
R4868:Olfr1318 UTSW 2 112156571 missense probably damaging 0.99
R4960:Olfr1318 UTSW 2 112156352 missense probably benign 0.00
R5121:Olfr1318 UTSW 2 112156286 missense possibly damaging 0.47
R6218:Olfr1318 UTSW 2 112156356 missense probably damaging 0.99
R6294:Olfr1318 UTSW 2 112156019 missense probably benign
R6350:Olfr1318 UTSW 2 112156197 missense probably damaging 0.99
R6515:Olfr1318 UTSW 2 112156365 missense probably benign 0.00
R6722:Olfr1318 UTSW 2 112156882 missense probably benign
R6829:Olfr1318 UTSW 2 112155794 intron probably benign
R7186:Olfr1318 UTSW 2 112156162 missense probably damaging 1.00
R7206:Olfr1318 UTSW 2 112156459 missense probably damaging 1.00
R7444:Olfr1318 UTSW 2 112156715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAACACTCCTCAGGTGCTTCCTC -3'
(R):5'- tgcccggctCACAGTAGCTTTT -3'

Sequencing Primer
(F):5'- TCAGGTGCTTCCTCCAAGG -3'
(R):5'- gacataaattttacacacacgtacag -3'
Posted On2013-05-09