Incidental Mutation 'R4380:Slc34a2'
ID 325288
Institutional Source Beutler Lab
Gene Symbol Slc34a2
Ensembl Gene ENSMUSG00000029188
Gene Name solute carrier family 34 (sodium phosphate), member 2
Synonyms D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b
MMRRC Submission 041678-MU
Accession Numbers

Genbank: NM_011402; MGI: 1342284

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4380 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 53038081-53071664 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 53069286 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 584 (P584S)
Ref Sequence ENSEMBL: ENSMUSP00000092380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094787]
AlphaFold Q9DBP0
Predicted Effect probably damaging
Transcript: ENSMUST00000094787
AA Change: P584S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: P584S

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 252 2.3e-26 PFAM
Pfam:Na_Pi_cotrans 374 551 2.6e-17 PFAM
low complexity region 553 570 N/A INTRINSIC
low complexity region 616 645 N/A INTRINSIC
low complexity region 649 655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147243
Predicted Effect probably damaging
Transcript: ENSMUST00000168667
AA Change: P525S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132328
Gene: ENSMUSG00000029188
AA Change: P525S

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 253 1.2e-33 PFAM
Pfam:Na_Pi_cotrans 379 517 4.1e-15 PFAM
low complexity region 557 586 N/A INTRINSIC
low complexity region 590 596 N/A INTRINSIC
Meta Mutation Damage Score 0.5592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik T C 7: 44,677,156 noncoding transcript Het
Casc3 C A 11: 98,823,031 P363Q possibly damaging Het
Cep162 C A 9: 87,200,003 R1283L probably damaging Het
Clk3 C A 9: 57,751,792 W562L probably damaging Het
Col17a1 G A 19: 47,657,090 T844M possibly damaging Het
Dntt G C 19: 41,053,233 G452A probably damaging Het
Dopey2 G A 16: 93,716,232 V20I possibly damaging Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Dync1li2 A T 8: 104,428,166 I270N probably damaging Het
Egflam A T 15: 7,243,869 I575N possibly damaging Het
Gldc G T 19: 30,160,768 probably benign Het
Gm13089 T A 4: 143,698,286 I196F probably benign Het
Gm17067 C A 7: 42,708,038 V347L probably benign Het
Gmds T A 13: 31,917,696 N304I probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Igfn1 T C 1: 135,967,771 T1686A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamb3 A T 1: 193,331,375 Q519L probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Macf1 A G 4: 123,354,492 probably benign Het
Mcfd2 C G 17: 87,257,959 G39R possibly damaging Het
Mecom T C 3: 29,987,070 H125R probably damaging Het
Nme7 A G 1: 164,345,238 T173A probably benign Het
Olfr1193 A G 2: 88,678,271 T132A possibly damaging Het
Olfr194 C T 16: 59,119,664 M135I probably benign Het
Pde1c T A 6: 56,072,278 R683S probably null Het
Pkn2 A T 3: 142,830,456 probably benign Het
Plppr4 T G 3: 117,322,397 T604P probably benign Het
Slco5a1 A T 1: 12,939,168 M361K probably damaging Het
Snx4 T A 16: 33,264,296 I60N probably damaging Het
Sp6 T C 11: 97,021,746 L95P probably damaging Het
Stat5b A G 11: 100,787,349 F646S probably damaging Het
Tbc1d1 T C 5: 64,333,548 M785T probably benign Het
Tbc1d22a T A 15: 86,351,734 C365S probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Tnfsf8 A T 4: 63,861,027 C11* probably null Het
Ttn A T 2: 76,918,141 V4188E probably damaging Het
Ugt2b5 T A 5: 87,127,894 H366L probably damaging Het
Wdr17 T C 8: 54,648,407 probably benign Het
Zfhx3 A G 8: 108,956,390 Y3487C unknown Het
Zfp28 C T 7: 6,393,442 T292I probably benign Het
Other mutations in Slc34a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Slc34a2 APN 5 53065608 missense probably benign 0.06
IGL00845:Slc34a2 APN 5 53058354 splice site probably benign
IGL01024:Slc34a2 APN 5 53067630 missense possibly damaging 0.61
IGL01300:Slc34a2 APN 5 53068127 critical splice acceptor site probably null
IGL01680:Slc34a2 APN 5 53060876 missense probably damaging 1.00
IGL02226:Slc34a2 APN 5 53067731 missense probably benign 0.12
IGL02682:Slc34a2 APN 5 53059238 missense possibly damaging 0.64
IGL03294:Slc34a2 APN 5 53063998 missense probably benign 0.00
tucumcari UTSW 5 53064009 missense possibly damaging 0.68
D4216:Slc34a2 UTSW 5 53065497 missense probably benign 0.01
R0094:Slc34a2 UTSW 5 53063968 missense probably benign 0.28
R0227:Slc34a2 UTSW 5 53069626 missense possibly damaging 0.51
R0524:Slc34a2 UTSW 5 53064873 nonsense probably null
R0836:Slc34a2 UTSW 5 53067707 missense probably benign
R1525:Slc34a2 UTSW 5 53069506 missense probably benign 0.00
R1655:Slc34a2 UTSW 5 53069419 missense probably benign 0.00
R1753:Slc34a2 UTSW 5 53061391 missense probably benign 0.37
R1838:Slc34a2 UTSW 5 53058436 missense probably benign
R2361:Slc34a2 UTSW 5 53068145 missense probably benign 0.10
R2405:Slc34a2 UTSW 5 53058181 missense probably benign 0.04
R3688:Slc34a2 UTSW 5 53064832 missense probably benign 0.06
R4108:Slc34a2 UTSW 5 53064009 missense possibly damaging 0.68
R4176:Slc34a2 UTSW 5 53067568 missense probably damaging 1.00
R4464:Slc34a2 UTSW 5 53069182 missense probably damaging 0.99
R4780:Slc34a2 UTSW 5 53069451 missense probably damaging 1.00
R4816:Slc34a2 UTSW 5 53069020 missense probably damaging 1.00
R4934:Slc34a2 UTSW 5 53067600 missense probably damaging 1.00
R5265:Slc34a2 UTSW 5 53061434 missense probably damaging 0.96
R5309:Slc34a2 UTSW 5 53069488 missense probably damaging 0.96
R5313:Slc34a2 UTSW 5 53069339 missense probably damaging 0.96
R5884:Slc34a2 UTSW 5 53069380 missense possibly damaging 0.46
R6084:Slc34a2 UTSW 5 53067647 missense possibly damaging 0.91
R6310:Slc34a2 UTSW 5 53064797 critical splice acceptor site probably null
R6568:Slc34a2 UTSW 5 53069134 missense probably damaging 1.00
R6817:Slc34a2 UTSW 5 53064028 missense probably damaging 0.98
R6845:Slc34a2 UTSW 5 53069169 missense probably damaging 0.96
R6944:Slc34a2 UTSW 5 53064883 missense probably benign
R7873:Slc34a2 UTSW 5 53058372 missense probably benign 0.02
R8114:Slc34a2 UTSW 5 53068359 missense probably benign 0.00
R8158:Slc34a2 UTSW 5 53060840 missense probably damaging 1.00
R8364:Slc34a2 UTSW 5 53068374 missense possibly damaging 0.75
R9158:Slc34a2 UTSW 5 53063875 missense possibly damaging 0.95
R9235:Slc34a2 UTSW 5 53069325 missense probably benign 0.00
R9314:Slc34a2 UTSW 5 53060801 missense possibly damaging 0.61
Z1176:Slc34a2 UTSW 5 53060817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAAGTATCGCTGGTTC -3'
(R):5'- ATTGTCAAAGGCCCCAGAAG -3'

Sequencing Primer
(F):5'- CAAGTATCGCTGGTTCGCAGTC -3'
(R):5'- CAGAAGCCTTGACCGGGATATC -3'
Posted On 2015-07-06