Incidental Mutation 'R4380:Dync1li2'
ID325298
Institutional Source Beutler Lab
Gene Symbol Dync1li2
Ensembl Gene ENSMUSG00000035770
Gene Namedynein, cytoplasmic 1 light intermediate chain 2
SynonymsLIC2, Dnclic2, Dncli2
MMRRC Submission 041678-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R4380 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104417680-104443047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104428166 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 270 (I270N)
Ref Sequence ENSEMBL: ENSMUSP00000148681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041769] [ENSMUST00000212654]
Predicted Effect probably damaging
Transcript: ENSMUST00000041769
AA Change: I270N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045480
Gene: ENSMUSG00000035770
AA Change: I270N

DomainStartEndE-ValueType
Pfam:DLIC 30 491 5.8e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212040
Predicted Effect unknown
Transcript: ENSMUST00000212230
AA Change: I197N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212343
Predicted Effect probably damaging
Transcript: ENSMUST00000212654
AA Change: I270N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.8334 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytoplasmic dynein is a microtubule-associated motor protein (Hughes et al., 1995 [PubMed 7738094]). See DYNC1H1 (MIM 600112) for general information about dyneins.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik T C 7: 44,677,156 noncoding transcript Het
Casc3 C A 11: 98,823,031 P363Q possibly damaging Het
Cep162 C A 9: 87,200,003 R1283L probably damaging Het
Clk3 C A 9: 57,751,792 W562L probably damaging Het
Col17a1 G A 19: 47,657,090 T844M possibly damaging Het
Dntt G C 19: 41,053,233 G452A probably damaging Het
Dopey2 G A 16: 93,716,232 V20I possibly damaging Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Egflam A T 15: 7,243,869 I575N possibly damaging Het
Gldc G T 19: 30,160,768 probably benign Het
Gm13089 T A 4: 143,698,286 I196F probably benign Het
Gm17067 C A 7: 42,708,038 V347L probably benign Het
Gmds T A 13: 31,917,696 N304I probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Igfn1 T C 1: 135,967,771 T1686A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamb3 A T 1: 193,331,375 Q519L probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Macf1 A G 4: 123,354,492 probably benign Het
Mcfd2 C G 17: 87,257,959 G39R possibly damaging Het
Mecom T C 3: 29,987,070 H125R probably damaging Het
Nme7 A G 1: 164,345,238 T173A probably benign Het
Olfr1193 A G 2: 88,678,271 T132A possibly damaging Het
Olfr194 C T 16: 59,119,664 M135I probably benign Het
Pde1c T A 6: 56,072,278 R683S probably null Het
Pkn2 A T 3: 142,830,456 probably benign Het
Plppr4 T G 3: 117,322,397 T604P probably benign Het
Slc34a2 C T 5: 53,069,286 P584S probably damaging Het
Slco5a1 A T 1: 12,939,168 M361K probably damaging Het
Snx4 T A 16: 33,264,296 I60N probably damaging Het
Sp6 T C 11: 97,021,746 L95P probably damaging Het
Stat5b A G 11: 100,787,349 F646S probably damaging Het
Tbc1d1 T C 5: 64,333,548 M785T probably benign Het
Tbc1d22a T A 15: 86,351,734 C365S probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Tnfsf8 A T 4: 63,861,027 C11* probably null Het
Ttn A T 2: 76,918,141 V4188E probably damaging Het
Ugt2b5 T A 5: 87,127,894 H366L probably damaging Het
Wdr17 T C 8: 54,648,407 probably benign Het
Zfhx3 A G 8: 108,956,390 Y3487C unknown Het
Zfp28 C T 7: 6,393,442 T292I probably benign Het
Other mutations in Dync1li2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Dync1li2 APN 8 104442498 missense possibly damaging 0.95
IGL01143:Dync1li2 APN 8 104429453 missense probably damaging 0.96
E0354:Dync1li2 UTSW 8 104425467 missense probably damaging 0.99
R0102:Dync1li2 UTSW 8 104428125 missense probably benign 0.00
R0102:Dync1li2 UTSW 8 104428125 missense probably benign 0.00
R0555:Dync1li2 UTSW 8 104420665 missense probably benign
R0784:Dync1li2 UTSW 8 104442498 missense probably damaging 0.99
R1532:Dync1li2 UTSW 8 104426035 missense probably damaging 1.00
R1632:Dync1li2 UTSW 8 104437491 missense probably damaging 0.99
R2877:Dync1li2 UTSW 8 104429415 missense probably damaging 1.00
R2878:Dync1li2 UTSW 8 104429415 missense probably damaging 1.00
R4272:Dync1li2 UTSW 8 104423143 missense probably damaging 0.96
R5050:Dync1li2 UTSW 8 104437441 missense probably damaging 1.00
R5218:Dync1li2 UTSW 8 104442547 nonsense probably null
R5501:Dync1li2 UTSW 8 104440472 critical splice donor site probably null
R5628:Dync1li2 UTSW 8 104420592 missense possibly damaging 0.95
R6542:Dync1li2 UTSW 8 104442764 missense probably benign 0.09
R6727:Dync1li2 UTSW 8 104440535 missense probably damaging 0.98
R7384:Dync1li2 UTSW 8 104442543 missense probably benign 0.06
R7627:Dync1li2 UTSW 8 104429508 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGAAGCCCTGCACTGAAAAG -3'
(R):5'- TGCATCCTACTACAGCCTCAG -3'

Sequencing Primer
(F):5'- TGCACTGAAAAGGCGCAC -3'
(R):5'- CAGCTGGAGAATTTATTTACTGTGC -3'
Posted On2015-07-06