Mutagenetix > Incidental Mutation

Incidental Mutation 'R4380:Casc3'

325303

Institutional Source

Beutler Lab

Gene Symbol

Casc3

Ensembl Gene

ENSMUSG00000078676

Gene Name

cancer susceptibility candidate 3

Synonyms

Btz, Mln51

MMRRC Submission

041678-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R4380 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98804905-98833814 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 98823031 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 363 (P363Q)

Ref Sequence

ENSEMBL: ENSMUSP00000130926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]

AlphaFold

Q8K3W3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000017384
AA Change: P363Q

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: P363Q

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147065

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169695
AA Change: P363Q

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: P363Q

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310016G11Rik	T	C	7: 44,677,156		noncoding transcript	Het
Cep162	C	A	9: 87,200,003	R1283L	probably damaging	Het
Clk3	C	A	9: 57,751,792	W562L	probably damaging	Het
Col17a1	G	A	19: 47,657,090	T844M	possibly damaging	Het
Dntt	G	C	19: 41,053,233	G452A	probably damaging	Het
Dopey2	G	A	16: 93,716,232	V20I	possibly damaging	Het
Dst	T	C	1: 34,163,235	S215P	probably damaging	Het
Dync1li2	A	T	8: 104,428,166	I270N	probably damaging	Het
Egflam	A	T	15: 7,243,869	I575N	possibly damaging	Het
Gldc	G	T	19: 30,160,768		probably benign	Het
Gm13089	T	A	4: 143,698,286	I196F	probably benign	Het
Gm17067	C	A	7: 42,708,038	V347L	probably benign	Het
Gmds	T	A	13: 31,917,696	N304I	probably benign	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Igfn1	T	C	1: 135,967,771	T1686A	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lamb3	A	T	1: 193,331,375	Q519L	probably benign	Het
Lrp10	C	T	14: 54,468,366	R338C	probably damaging	Het
Macf1	A	G	4: 123,354,492		probably benign	Het
Mcfd2	C	G	17: 87,257,959	G39R	possibly damaging	Het
Mecom	T	C	3: 29,987,070	H125R	probably damaging	Het
Nme7	A	G	1: 164,345,238	T173A	probably benign	Het
Olfr1193	A	G	2: 88,678,271	T132A	possibly damaging	Het
Olfr194	C	T	16: 59,119,664	M135I	probably benign	Het
Pde1c	T	A	6: 56,072,278	R683S	probably null	Het
Pkn2	A	T	3: 142,830,456		probably benign	Het
Plppr4	T	G	3: 117,322,397	T604P	probably benign	Het
Slc34a2	C	T	5: 53,069,286	P584S	probably damaging	Het
Slco5a1	A	T	1: 12,939,168	M361K	probably damaging	Het
Snx4	T	A	16: 33,264,296	I60N	probably damaging	Het
Sp6	T	C	11: 97,021,746	L95P	probably damaging	Het
Stat5b	A	G	11: 100,787,349	F646S	probably damaging	Het
Tbc1d1	T	C	5: 64,333,548	M785T	probably benign	Het
Tbc1d22a	T	A	15: 86,351,734	C365S	probably damaging	Het
Tle1	ACAGGTTTCTTCAGGTTTCTT	ACAGGTTTCTT	4: 72,118,163		probably benign	Het
Tnfsf8	A	T	4: 63,861,027	C11*	probably null	Het
Ttn	A	T	2: 76,918,141	V4188E	probably damaging	Het
Ugt2b5	T	A	5: 87,127,894	H366L	probably damaging	Het
Wdr17	T	C	8: 54,648,407		probably benign	Het
Zfhx3	A	G	8: 108,956,390	Y3487C	unknown	Het
Zfp28	C	T	7: 6,393,442	T292I	probably benign	Het

Other mutations in Casc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Casc3	APN	11	98823202	missense	possibly damaging	0.62
IGL01566:Casc3	APN	11	98823401	critical splice donor site	probably null
IGL01901:Casc3	APN	11	98823121	missense	probably damaging	1.00
IGL02345:Casc3	APN	11	98827564	splice site	probably benign
IGL02875:Casc3	APN	11	98821552	missense	probably damaging	1.00
IGL02964:Casc3	APN	11	98828923	missense	probably damaging	0.96
R0147:Casc3	UTSW	11	98822499	missense	possibly damaging	0.89
R0195:Casc3	UTSW	11	98821493	missense	probably damaging	0.99
R0763:Casc3	UTSW	11	98831318	missense	probably damaging	1.00
R1581:Casc3	UTSW	11	98822818	missense	possibly damaging	0.66
R2021:Casc3	UTSW	11	98821506	missense	probably benign	0.01
R4612:Casc3	UTSW	11	98822958	missense	probably benign	0.13
R4988:Casc3	UTSW	11	98821874	splice site	probably null
R5079:Casc3	UTSW	11	98810426	intron	probably benign
R5442:Casc3	UTSW	11	98821471	missense	probably damaging	0.99
R5511:Casc3	UTSW	11	98810914	nonsense	probably null
R5873:Casc3	UTSW	11	98821444	missense	unknown
R6041:Casc3	UTSW	11	98828559	missense	probably damaging	1.00
R6685:Casc3	UTSW	11	98822530	missense	probably damaging	0.99
R7030:Casc3	UTSW	11	98822533	missense	possibly damaging	0.74
R7107:Casc3	UTSW	11	98827587	missense	possibly damaging	0.93
R7594:Casc3	UTSW	11	98821485	missense	probably benign	0.04
R7659:Casc3	UTSW	11	98809873	missense	unknown
R7660:Casc3	UTSW	11	98809873	missense	unknown
R8443:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8444:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8491:Casc3	UTSW	11	98823151	missense	probably benign	0.27
R8516:Casc3	UTSW	11	98822781	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTATTAACAGGAACACGGCAGG -3'
(R):5'- CCTTCAGATGGAGGAGGAAC -3'

Sequencing Primer
(F):5'- AGGTACTGGCCGCATGTCTG -3'
(R):5'- GGAACCTCCTCAGCAGCTTTG -3'

Posted On

2015-07-06