Incidental Mutation 'R4380:Lrp10'
ID325306
Institutional Source Beutler Lab
Gene Symbol Lrp10
Ensembl Gene ENSMUSG00000022175
Gene Namelow-density lipoprotein receptor-related protein 10
SynonymsLrp9
MMRRC Submission 041678-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4380 (G1)
Quality Score220
Status Not validated
Chromosome14
Chromosomal Location54464137-54471497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54468366 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 338 (R338C)
Ref Sequence ENSEMBL: ENSMUSP00000022782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022782] [ENSMUST00000227760]
Predicted Effect probably damaging
Transcript: ENSMUST00000022782
AA Change: R338C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022782
Gene: ENSMUSG00000022175
AA Change: R338C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CUB 29 137 5.33e-2 SMART
LDLa 140 177 5.26e-13 SMART
CUB 193 306 2.57e-4 SMART
LDLa 308 356 1.05e-3 SMART
LDLa 357 399 4.89e-2 SMART
LDLa 400 436 1.63e-9 SMART
transmembrane domain 442 464 N/A INTRINSIC
low complexity region 544 569 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 634 655 N/A INTRINSIC
low complexity region 672 681 N/A INTRINSIC
low complexity region 685 710 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226472
Predicted Effect probably benign
Transcript: ENSMUST00000227760
Predicted Effect probably benign
Transcript: ENSMUST00000228407
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a low density lipoprotein receptor family protein. A similar protein in mouse is thought to play a role in the uptake of apolipoprotein E-containing lipoproteins. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik T C 7: 44,677,156 noncoding transcript Het
Casc3 C A 11: 98,823,031 P363Q possibly damaging Het
Cep162 C A 9: 87,200,003 R1283L probably damaging Het
Clk3 C A 9: 57,751,792 W562L probably damaging Het
Col17a1 G A 19: 47,657,090 T844M possibly damaging Het
Dntt G C 19: 41,053,233 G452A probably damaging Het
Dopey2 G A 16: 93,716,232 V20I possibly damaging Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Dync1li2 A T 8: 104,428,166 I270N probably damaging Het
Egflam A T 15: 7,243,869 I575N possibly damaging Het
Gldc G T 19: 30,160,768 probably benign Het
Gm13089 T A 4: 143,698,286 I196F probably benign Het
Gm17067 C A 7: 42,708,038 V347L probably benign Het
Gmds T A 13: 31,917,696 N304I probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Igfn1 T C 1: 135,967,771 T1686A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamb3 A T 1: 193,331,375 Q519L probably benign Het
Macf1 A G 4: 123,354,492 probably benign Het
Mcfd2 C G 17: 87,257,959 G39R possibly damaging Het
Mecom T C 3: 29,987,070 H125R probably damaging Het
Nme7 A G 1: 164,345,238 T173A probably benign Het
Olfr1193 A G 2: 88,678,271 T132A possibly damaging Het
Olfr194 C T 16: 59,119,664 M135I probably benign Het
Pde1c T A 6: 56,072,278 R683S probably null Het
Pkn2 A T 3: 142,830,456 probably benign Het
Plppr4 T G 3: 117,322,397 T604P probably benign Het
Slc34a2 C T 5: 53,069,286 P584S probably damaging Het
Slco5a1 A T 1: 12,939,168 M361K probably damaging Het
Snx4 T A 16: 33,264,296 I60N probably damaging Het
Sp6 T C 11: 97,021,746 L95P probably damaging Het
Stat5b A G 11: 100,787,349 F646S probably damaging Het
Tbc1d1 T C 5: 64,333,548 M785T probably benign Het
Tbc1d22a T A 15: 86,351,734 C365S probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Tnfsf8 A T 4: 63,861,027 C11* probably null Het
Ttn A T 2: 76,918,141 V4188E probably damaging Het
Ugt2b5 T A 5: 87,127,894 H366L probably damaging Het
Wdr17 T C 8: 54,648,407 probably benign Het
Zfhx3 A G 8: 108,956,390 Y3487C unknown Het
Zfp28 C T 7: 6,393,442 T292I probably benign Het
Other mutations in Lrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Lrp10 APN 14 54468662 nonsense probably null
IGL02641:Lrp10 APN 14 54468611 nonsense probably null
IGL02697:Lrp10 APN 14 54469697 missense probably damaging 1.00
IGL02974:Lrp10 APN 14 54467884 nonsense probably null
IGL03030:Lrp10 APN 14 54469162 missense possibly damaging 0.69
chowmein UTSW 14 54468090 missense probably damaging 1.00
egg_fu_young UTSW 14 54469266 missense possibly damaging 0.66
R0452:Lrp10 UTSW 14 54467579 missense probably benign 0.08
R0765:Lrp10 UTSW 14 54468090 missense probably damaging 1.00
R1700:Lrp10 UTSW 14 54469752 missense possibly damaging 0.94
R1726:Lrp10 UTSW 14 54469656 missense probably damaging 0.99
R2943:Lrp10 UTSW 14 54469845 unclassified probably benign
R3746:Lrp10 UTSW 14 54469266 missense possibly damaging 0.66
R3749:Lrp10 UTSW 14 54469266 missense possibly damaging 0.66
R4356:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4357:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4358:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4379:Lrp10 UTSW 14 54468366 missense probably damaging 0.98
R4751:Lrp10 UTSW 14 54468592 missense probably damaging 1.00
R5055:Lrp10 UTSW 14 54468345 missense probably benign 0.00
R5133:Lrp10 UTSW 14 54469610 missense probably benign
R6633:Lrp10 UTSW 14 54469074 missense probably benign 0.03
R6845:Lrp10 UTSW 14 54469688 missense probably damaging 1.00
R6874:Lrp10 UTSW 14 54468213 missense possibly damaging 0.50
R6958:Lrp10 UTSW 14 54469821 unclassified probably benign
R6989:Lrp10 UTSW 14 54468493 missense probably benign 0.30
R7162:Lrp10 UTSW 14 54465706 missense possibly damaging 0.60
R7453:Lrp10 UTSW 14 54468456 missense probably damaging 1.00
R7600:Lrp10 UTSW 14 54469395 missense possibly damaging 0.93
X0026:Lrp10 UTSW 14 54469399 nonsense probably null
X0027:Lrp10 UTSW 14 54468535 missense probably damaging 1.00
Z1088:Lrp10 UTSW 14 54467922 missense probably benign 0.01
Z1177:Lrp10 UTSW 14 54467561 missense possibly damaging 0.75
Predicted Primers
Posted On2015-07-06