Incidental Mutation 'R4380:Gldc'
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
MMRRC Submission 041678-MU
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4380 (G1)
Quality Score189
Status Validated
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 30160768 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably benign
Transcript: ENSMUST00000025778
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827

low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000080982
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik T C 7: 44,677,156 noncoding transcript Het
Casc3 C A 11: 98,823,031 P363Q possibly damaging Het
Cep162 C A 9: 87,200,003 R1283L probably damaging Het
Clk3 C A 9: 57,751,792 W562L probably damaging Het
Col17a1 G A 19: 47,657,090 T844M possibly damaging Het
Dntt G C 19: 41,053,233 G452A probably damaging Het
Dopey2 G A 16: 93,716,232 V20I possibly damaging Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Dync1li2 A T 8: 104,428,166 I270N probably damaging Het
Egflam A T 15: 7,243,869 I575N possibly damaging Het
Gm13089 T A 4: 143,698,286 I196F probably benign Het
Gm17067 C A 7: 42,708,038 V347L probably benign Het
Gmds T A 13: 31,917,696 N304I probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Igfn1 T C 1: 135,967,771 T1686A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamb3 A T 1: 193,331,375 Q519L probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Macf1 A G 4: 123,354,492 probably benign Het
Mcfd2 C G 17: 87,257,959 G39R possibly damaging Het
Mecom T C 3: 29,987,070 H125R probably damaging Het
Nme7 A G 1: 164,345,238 T173A probably benign Het
Olfr1193 A G 2: 88,678,271 T132A possibly damaging Het
Olfr194 C T 16: 59,119,664 M135I probably benign Het
Pde1c T A 6: 56,072,278 R683S probably null Het
Pkn2 A T 3: 142,830,456 probably benign Het
Plppr4 T G 3: 117,322,397 T604P probably benign Het
Slc34a2 C T 5: 53,069,286 P584S probably damaging Het
Slco5a1 A T 1: 12,939,168 M361K probably damaging Het
Snx4 T A 16: 33,264,296 I60N probably damaging Het
Sp6 T C 11: 97,021,746 L95P probably damaging Het
Stat5b A G 11: 100,787,349 F646S probably damaging Het
Tbc1d1 T C 5: 64,333,548 M785T probably benign Het
Tbc1d22a T A 15: 86,351,734 C365S probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Tnfsf8 A T 4: 63,861,027 C11* probably null Het
Ttn A T 2: 76,918,141 V4188E probably damaging Het
Ugt2b5 T A 5: 87,127,894 H366L probably damaging Het
Wdr17 T C 8: 54,648,407 probably benign Het
Zfhx3 A G 8: 108,956,390 Y3487C unknown Het
Zfp28 C T 7: 6,393,442 T292I probably benign Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8374:Gldc UTSW 19 30137194 missense probably damaging 1.00
R8503:Gldc UTSW 19 30099854 missense probably benign 0.26
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8818:Gldc UTSW 19 30100812 missense probably benign 0.05
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8829:Gldc UTSW 19 30100812 missense probably benign 0.05
R8830:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
R8887:Gldc UTSW 19 30133756 missense possibly damaging 0.94
R8935:Gldc UTSW 19 30131693 missense probably benign 0.00
R8940:Gldc UTSW 19 30151484 missense probably benign
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-06