Incidental Mutation 'R4381:Gpr158'
ID 325319
Institutional Source Beutler Lab
Gene Symbol Gpr158
Ensembl Gene ENSMUSG00000045967
Gene Name G protein-coupled receptor 158
Synonyms 5330427M13Rik
MMRRC Submission 041122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4381 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 21367542-21830547 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21827592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 1168 (W1168R)
Ref Sequence ENSEMBL: ENSMUSP00000049708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055946]
AlphaFold Q8C419
Predicted Effect probably damaging
Transcript: ENSMUST00000055946
AA Change: W1168R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: W1168R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 110 125 N/A INTRINSIC
SCOP:d1edmb_ 313 359 5e-4 SMART
Blast:EGF 318 365 2e-27 BLAST
Pfam:7tm_3 426 669 1.2e-35 PFAM
low complexity region 840 863 N/A INTRINSIC
Meta Mutation Damage Score 0.4719 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Dlgap2 A G 8: 14,846,502 I993V probably benign Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Eml5 A G 12: 98,815,955 I1359T possibly damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
Ighv1-62-1 T A 12: 115,386,993 H18L probably benign Het
Il18r1 A G 1: 40,471,790 I12V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mib2 G C 4: 155,657,612 A234G possibly damaging Het
Mtpap T C 18: 4,383,223 F200S probably benign Het
Nacad T A 11: 6,600,204 T996S probably benign Het
Nek9 T A 12: 85,329,858 T250S probably damaging Het
Nif3l1 A C 1: 58,455,579 probably benign Het
Nipbl A G 15: 8,359,206 V310A probably benign Het
Olfr119 G T 17: 37,700,899 E76D probably damaging Het
Olfr854 A G 9: 19,566,742 L211P probably benign Het
Pbrm1 T C 14: 31,025,556 V33A probably benign Het
Pcdha4 A G 18: 36,952,875 E37G probably damaging Het
Pdgfc A G 3: 81,209,251 K304R probably damaging Het
Peak1 G T 9: 56,258,427 A739E probably benign Het
Pla2g4c A T 7: 13,346,065 N433Y probably damaging Het
Polrmt A C 10: 79,741,808 L319R possibly damaging Het
Prkaa1 A T 15: 5,176,808 T373S probably benign Het
Qars G A 9: 108,510,183 probably benign Het
Ranbp1 G A 16: 18,247,344 L33F probably damaging Het
Rpgrip1 C T 14: 52,150,449 P1094L possibly damaging Het
Taf1d T A 9: 15,311,981 probably benign Het
Tstd2 T C 4: 46,119,933 K340E probably benign Het
Vmn2r45 A T 7: 8,471,913 C705* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zdhhc16 A G 19: 41,940,654 Y232C possibly damaging Het
Zfp1 T A 8: 111,670,451 L354Q probably damaging Het
Zyg11a G A 4: 108,201,320 A341V possibly damaging Het
Other mutations in Gpr158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gpr158 APN 2 21368683 missense probably damaging 1.00
IGL00469:Gpr158 APN 2 21746795 splice site probably benign
IGL00706:Gpr158 APN 2 21746773 missense probably damaging 1.00
IGL00780:Gpr158 APN 2 21826818 nonsense probably null
IGL00885:Gpr158 APN 2 21649021 missense probably damaging 1.00
IGL01339:Gpr158 APN 2 21369031 missense possibly damaging 0.73
IGL01368:Gpr158 APN 2 21827098 missense probably damaging 1.00
IGL02141:Gpr158 APN 2 21783290 missense probably damaging 0.99
IGL02455:Gpr158 APN 2 21368700 missense probably benign 0.00
IGL02554:Gpr158 APN 2 21826596 missense probably benign
IGL02681:Gpr158 APN 2 21815630 missense probably damaging 1.00
IGL02752:Gpr158 APN 2 21826827 missense possibly damaging 0.95
IGL02756:Gpr158 APN 2 21827079 missense possibly damaging 0.47
IGL03181:Gpr158 APN 2 21783161 missense probably benign 0.02
IGL03258:Gpr158 APN 2 21825274 missense probably damaging 1.00
IGL03386:Gpr158 APN 2 21826246 missense probably damaging 1.00
PIT4810001:Gpr158 UTSW 2 21826871 missense probably benign 0.01
R0071:Gpr158 UTSW 2 21810668 missense probably benign 0.08
R0081:Gpr158 UTSW 2 21826717 missense probably damaging 1.00
R0528:Gpr158 UTSW 2 21825208 missense probably damaging 1.00
R0560:Gpr158 UTSW 2 21825274 missense probably damaging 1.00
R0603:Gpr158 UTSW 2 21815669 missense possibly damaging 0.67
R1560:Gpr158 UTSW 2 21826314 missense probably damaging 1.00
R1561:Gpr158 UTSW 2 21815694 splice site probably null
R1609:Gpr158 UTSW 2 21783293 missense possibly damaging 0.61
R1741:Gpr158 UTSW 2 21827548 missense probably benign 0.00
R1827:Gpr158 UTSW 2 21827318 missense probably benign
R1854:Gpr158 UTSW 2 21369124 missense probably damaging 1.00
R1871:Gpr158 UTSW 2 21815615 missense probably damaging 1.00
R2151:Gpr158 UTSW 2 21827514 missense possibly damaging 0.82
R2273:Gpr158 UTSW 2 21826863 missense probably benign
R2275:Gpr158 UTSW 2 21826863 missense probably benign
R3004:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R3151:Gpr158 UTSW 2 21576960 missense possibly damaging 0.68
R3943:Gpr158 UTSW 2 21368559 missense possibly damaging 0.65
R4238:Gpr158 UTSW 2 21368551 missense probably damaging 1.00
R4379:Gpr158 UTSW 2 21825214 missense probably damaging 1.00
R4464:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4467:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4496:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4506:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4530:Gpr158 UTSW 2 21369000 missense probably benign 0.03
R4646:Gpr158 UTSW 2 21827053 missense probably benign
R4798:Gpr158 UTSW 2 21783182 missense probably damaging 1.00
R4882:Gpr158 UTSW 2 21825248 missense probably damaging 0.98
R4943:Gpr158 UTSW 2 21827157 missense probably damaging 1.00
R5334:Gpr158 UTSW 2 21827505 missense probably benign 0.01
R5560:Gpr158 UTSW 2 21826290 missense possibly damaging 0.67
R5600:Gpr158 UTSW 2 21827235 missense probably benign
R5637:Gpr158 UTSW 2 21783272 missense probably benign 0.00
R5701:Gpr158 UTSW 2 21746709 missense probably damaging 1.00
R5744:Gpr158 UTSW 2 21368520 missense probably damaging 1.00
R5911:Gpr158 UTSW 2 21369121 missense possibly damaging 0.95
R5991:Gpr158 UTSW 2 21368508 missense probably damaging 0.99
R6200:Gpr158 UTSW 2 21399416 missense probably damaging 0.97
R6306:Gpr158 UTSW 2 21815611 missense possibly damaging 0.84
R6324:Gpr158 UTSW 2 21810554 missense probably damaging 1.00
R6384:Gpr158 UTSW 2 21826288 missense probably damaging 1.00
R6698:Gpr158 UTSW 2 21827110 missense probably damaging 1.00
R6997:Gpr158 UTSW 2 21648991 missense possibly damaging 0.46
R7086:Gpr158 UTSW 2 21826575 missense probably benign 0.01
R7175:Gpr158 UTSW 2 21368302 missense probably benign 0.13
R7197:Gpr158 UTSW 2 21810601 missense probably damaging 0.99
R7293:Gpr158 UTSW 2 21576939 missense possibly damaging 0.47
R7427:Gpr158 UTSW 2 21827318 missense probably benign
R7515:Gpr158 UTSW 2 21368281 missense probably damaging 1.00
R7730:Gpr158 UTSW 2 21826347 missense probably damaging 1.00
R8122:Gpr158 UTSW 2 21826863 missense probably benign
R8311:Gpr158 UTSW 2 21368890 missense probably benign 0.00
R8754:Gpr158 UTSW 2 21576882 missense probably benign 0.00
R8782:Gpr158 UTSW 2 21399338 missense probably damaging 1.00
R8792:Gpr158 UTSW 2 21553326 missense probably damaging 1.00
R8842:Gpr158 UTSW 2 21576940 missense possibly damaging 0.88
R9009:Gpr158 UTSW 2 21576949 missense probably damaging 1.00
R9102:Gpr158 UTSW 2 21825267 missense probably damaging 1.00
R9150:Gpr158 UTSW 2 21826440 missense probably benign 0.17
R9254:Gpr158 UTSW 2 21368231 start gained probably benign
R9317:Gpr158 UTSW 2 21827226 missense probably benign
R9379:Gpr158 UTSW 2 21368231 start gained probably benign
R9428:Gpr158 UTSW 2 21783161 missense probably benign
R9497:Gpr158 UTSW 2 21827014 missense probably benign 0.00
R9667:Gpr158 UTSW 2 21825243 missense probably damaging 0.99
R9681:Gpr158 UTSW 2 21826504 missense probably damaging 0.99
X0062:Gpr158 UTSW 2 21826369 missense probably damaging 1.00
Z1176:Gpr158 UTSW 2 21810690 critical splice donor site probably null
Z1177:Gpr158 UTSW 2 21827272 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GGCAATATGAAGAACTGCCCC -3'
(R):5'- TGCCATGTTTCCCTAGGCTAAC -3'

Sequencing Primer
(F):5'- TGCCCCACAAAGTCGTAGC -3'
(R):5'- GTTTCCCTAGGCTAACAAAGATGC -3'
Posted On 2015-07-06