Incidental Mutation 'R4381:Zyg11a'
ID325324
Institutional Source Beutler Lab
Gene Symbol Zyg11a
Ensembl Gene ENSMUSG00000034645
Gene Namezyg-11 family member A, cell cycle regulator
Synonyms
MMRRC Submission 041122-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R4381 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108181738-108218048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108201320 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 341 (A341V)
Ref Sequence ENSEMBL: ENSMUSP00000152477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043793] [ENSMUST00000106690] [ENSMUST00000223127]
Predicted Effect probably benign
Transcript: ENSMUST00000043793
AA Change: A339V

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038478
Gene: ENSMUSG00000034645
AA Change: A339V

DomainStartEndE-ValueType
SCOP:d1jdha_ 218 700 2e-11 SMART
Blast:ARM 497 544 1e-5 BLAST
Blast:ARM 547 587 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106690
AA Change: A341V

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102301
Gene: ENSMUSG00000034645
AA Change: A341V

DomainStartEndE-ValueType
SCOP:d1jdha_ 139 621 1e-11 SMART
Blast:ARM 418 465 1e-5 BLAST
Blast:ARM 468 508 1e-7 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000223127
AA Change: A341V

PolyPhen 2 Score 0.582 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.2555 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Dlgap2 A G 8: 14,846,502 I993V probably benign Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Eml5 A G 12: 98,815,955 I1359T possibly damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
Gpr158 T A 2: 21,827,592 W1168R probably damaging Het
Ighv1-62-1 T A 12: 115,386,993 H18L probably benign Het
Il18r1 A G 1: 40,471,790 I12V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mib2 G C 4: 155,657,612 A234G possibly damaging Het
Mtpap T C 18: 4,383,223 F200S probably benign Het
Nacad T A 11: 6,600,204 T996S probably benign Het
Nek9 T A 12: 85,329,858 T250S probably damaging Het
Nif3l1 A C 1: 58,455,579 probably benign Het
Nipbl A G 15: 8,359,206 V310A probably benign Het
Olfr119 G T 17: 37,700,899 E76D probably damaging Het
Olfr854 A G 9: 19,566,742 L211P probably benign Het
Pbrm1 T C 14: 31,025,556 V33A probably benign Het
Pcdha4 A G 18: 36,952,875 E37G probably damaging Het
Pdgfc A G 3: 81,209,251 K304R probably damaging Het
Peak1 G T 9: 56,258,427 A739E probably benign Het
Pla2g4c A T 7: 13,346,065 N433Y probably damaging Het
Polrmt A C 10: 79,741,808 L319R possibly damaging Het
Prkaa1 A T 15: 5,176,808 T373S probably benign Het
Qars G A 9: 108,510,183 probably benign Het
Ranbp1 G A 16: 18,247,344 L33F probably damaging Het
Rpgrip1 C T 14: 52,150,449 P1094L possibly damaging Het
Taf1d T A 9: 15,311,981 probably benign Het
Tstd2 T C 4: 46,119,933 K340E probably benign Het
Vmn2r45 A T 7: 8,471,913 C705* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zdhhc16 A G 19: 41,940,654 Y232C possibly damaging Het
Zfp1 T A 8: 111,670,451 L354Q probably damaging Het
Other mutations in Zyg11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Zyg11a APN 4 108204902 missense probably damaging 0.99
IGL01517:Zyg11a APN 4 108201194 missense probably null 1.00
IGL01619:Zyg11a APN 4 108205217 missense probably damaging 1.00
IGL02253:Zyg11a APN 4 108183695 missense probably null 0.99
R0090:Zyg11a UTSW 4 108201347 splice site probably benign
R0225:Zyg11a UTSW 4 108204641 missense probably damaging 1.00
R0610:Zyg11a UTSW 4 108204857 missense probably damaging 1.00
R0827:Zyg11a UTSW 4 108210042 splice site probably benign
R1568:Zyg11a UTSW 4 108183646 critical splice donor site probably null
R1752:Zyg11a UTSW 4 108205282 missense possibly damaging 0.81
R2051:Zyg11a UTSW 4 108192047 splice site probably benign
R2358:Zyg11a UTSW 4 108196146 missense possibly damaging 0.94
R3898:Zyg11a UTSW 4 108210194 missense probably damaging 0.99
R4288:Zyg11a UTSW 4 108184469 missense probably damaging 1.00
R4709:Zyg11a UTSW 4 108205071 missense probably benign 0.00
R4859:Zyg11a UTSW 4 108210190 missense probably damaging 0.98
R5303:Zyg11a UTSW 4 108184432 critical splice donor site probably null
R5349:Zyg11a UTSW 4 108183732 missense probably damaging 1.00
R5363:Zyg11a UTSW 4 108189622 missense probably damaging 1.00
R5517:Zyg11a UTSW 4 108204746 missense possibly damaging 0.94
R6175:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R6254:Zyg11a UTSW 4 108181794 missense probably damaging 1.00
R6678:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R7524:Zyg11a UTSW 4 108192074 missense probably damaging 1.00
R7789:Zyg11a UTSW 4 108183648 missense probably damaging 1.00
R8022:Zyg11a UTSW 4 108189568 critical splice donor site probably null
X0061:Zyg11a UTSW 4 108193993 missense probably damaging 1.00
Z1176:Zyg11a UTSW 4 108201282 missense probably damaging 1.00
Z1177:Zyg11a UTSW 4 108204800 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CACAAACATCACGTCATTTGGG -3'
(R):5'- TCATTGGAGACATGTGCAGG -3'

Sequencing Primer
(F):5'- ACTATGTAGACCATGCTGGC -3'
(R):5'- CATTGGAGACATGTGCAGGTTGTG -3'
Posted On2015-07-06