Incidental Mutation 'R0012:Tbx15'
ID 32533
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 038307-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R0012 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99259412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 428 (T428A)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
AlphaFold O70306
Predicted Effect probably benign
Transcript: ENSMUST00000029462
AA Change: T428A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: T428A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 A T 2: 130,894,840 (GRCm39) L687Q probably damaging Het
Adap1 A G 5: 139,293,489 (GRCm39) probably benign Het
Add2 T A 6: 86,075,610 (GRCm39) V253E probably damaging Het
Agtr1a A T 13: 30,565,732 (GRCm39) I266F probably damaging Het
Anxa9 A G 3: 95,215,406 (GRCm39) probably benign Het
Arap2 G A 5: 62,840,827 (GRCm39) L680F probably damaging Het
Bnip3 A G 7: 138,500,401 (GRCm39) probably benign Het
Brwd1 A C 16: 95,860,852 (GRCm39) S311R probably damaging Het
C2cd3 G A 7: 100,067,729 (GRCm39) V871M possibly damaging Het
Cacul1 A G 19: 60,552,691 (GRCm39) W145R probably damaging Het
Celf5 C A 10: 81,305,346 (GRCm39) V141L probably damaging Het
Cfap206 C A 4: 34,714,519 (GRCm39) L392F possibly damaging Het
Chd2 G T 7: 73,105,267 (GRCm39) T192K probably damaging Het
Chrna10 T C 7: 101,764,264 (GRCm39) N40S possibly damaging Het
Cic T A 7: 24,986,565 (GRCm39) S1299T probably damaging Het
Cic C A 7: 24,986,566 (GRCm39) S1299Y probably damaging Het
Clspn T A 4: 126,458,722 (GRCm39) probably benign Het
Clstn1 G A 4: 149,719,253 (GRCm39) V361M probably damaging Het
Col5a3 A T 9: 20,688,404 (GRCm39) probably benign Het
Copb1 T A 7: 113,836,643 (GRCm39) K366N probably damaging Het
Cul9 G A 17: 46,849,436 (GRCm39) R570C probably benign Het
Cyp2c70 A T 19: 40,175,687 (GRCm39) L7Q probably null Het
Dock2 T C 11: 34,674,622 (GRCm39) E10G possibly damaging Het
Dpysl4 T G 7: 138,677,799 (GRCm39) I412S probably benign Het
Eaf2 T A 16: 36,628,536 (GRCm39) probably benign Het
Fasl T C 1: 161,615,733 (GRCm39) D41G probably benign Het
Fat2 A G 11: 55,153,697 (GRCm39) V3505A probably benign Het
Fbxo24 A G 5: 137,620,256 (GRCm39) F101S probably damaging Het
Fdft1 T C 14: 63,415,147 (GRCm39) I28M probably benign Het
Gcnt3 T C 9: 69,941,367 (GRCm39) I400M probably benign Het
Get3 T C 8: 85,751,725 (GRCm39) probably benign Het
Gpd2 T A 2: 57,228,880 (GRCm39) M228K probably damaging Het
Gsap T A 5: 21,431,227 (GRCm39) probably benign Het
Hipk1 A G 3: 103,670,996 (GRCm39) M467T probably damaging Het
Hmgb4 T A 4: 128,154,518 (GRCm39) I17F probably damaging Het
Ints10 C A 8: 69,260,127 (GRCm39) L284M probably benign Het
Kif17 T G 4: 138,021,059 (GRCm39) S606A probably damaging Het
Lifr C A 15: 7,205,089 (GRCm39) T442K possibly damaging Het
Lypd4 A G 7: 24,564,757 (GRCm39) L127P probably damaging Het
Lyst A G 13: 13,862,279 (GRCm39) H2605R probably benign Het
Map3k4 A G 17: 12,457,076 (GRCm39) S1289P probably damaging Het
Mgam T A 6: 40,742,190 (GRCm39) probably null Het
Mob1b G A 5: 88,903,943 (GRCm39) probably benign Het
Mrgpra1 A G 7: 46,985,218 (GRCm39) S154P probably damaging Het
Ms4a4c C A 19: 11,396,344 (GRCm39) probably benign Het
Mthfd2l A T 5: 91,109,242 (GRCm39) H224L probably damaging Het
Myh8 T C 11: 67,190,847 (GRCm39) Y1350H probably benign Het
Nectin2 T C 7: 19,464,669 (GRCm39) probably benign Het
Nos1 A C 5: 118,031,967 (GRCm39) N305T probably damaging Het
Ogfrl1 T A 1: 23,409,206 (GRCm39) Q340L possibly damaging Het
Or2aj5 T C 16: 19,425,190 (GRCm39) N76S probably benign Het
Or4f62 A T 2: 111,987,171 (GRCm39) N292Y possibly damaging Het
Or6k14 T G 1: 173,927,773 (GRCm39) F250V probably damaging Het
Or9i1 C A 19: 13,839,187 (GRCm39) T10K probably damaging Het
Orc1 T C 4: 108,452,843 (GRCm39) probably null Het
Plekhg5 C A 4: 152,189,207 (GRCm39) D249E probably benign Het
Plet1 A G 9: 50,410,430 (GRCm39) I74V probably benign Het
Psmd2 T A 16: 20,480,434 (GRCm39) D718E probably damaging Het
Rab33b G T 3: 51,391,737 (GRCm39) probably benign Het
Rae1 T A 2: 172,844,466 (GRCm39) F4I unknown Het
Ralgapa2 A G 2: 146,254,672 (GRCm39) Y821H probably benign Het
Scd2 G A 19: 44,289,685 (GRCm39) V227I probably benign Het
Sharpin G T 15: 76,232,543 (GRCm39) P156T possibly damaging Het
Slc38a4 C T 15: 96,897,510 (GRCm39) R435H probably damaging Het
Snrnp200 T C 2: 127,070,469 (GRCm39) V1061A probably benign Het
Suclg1 A G 6: 73,247,980 (GRCm39) T234A possibly damaging Het
Swsap1 T C 9: 21,868,318 (GRCm39) C197R probably benign Het
Tet2 T C 3: 133,182,319 (GRCm39) Y1215C probably damaging Het
Tjp1 A G 7: 64,979,523 (GRCm39) probably benign Het
Tmem209 G T 6: 30,502,112 (GRCm39) probably benign Het
Tnpo3 T C 6: 29,589,176 (GRCm39) E58G probably damaging Het
Trp53bp2 T A 1: 182,272,283 (GRCm39) M464K probably damaging Het
Ttc32 A G 12: 9,085,897 (GRCm39) Y148C possibly damaging Het
Unc80 T C 1: 66,546,550 (GRCm39) S541P probably damaging Het
Ushbp1 T C 8: 71,847,684 (GRCm39) probably benign Het
Vmn2r100 A G 17: 19,725,136 (GRCm39) M22V probably benign Het
Vmn2r100 A T 17: 19,746,296 (GRCm39) E485V probably damaging Het
Wdr24 G A 17: 26,046,087 (GRCm39) V471I probably benign Het
Zfp35 T A 18: 24,136,001 (GRCm39) M115K probably benign Het
Zfp429 G A 13: 67,538,796 (GRCm39) S216L probably benign Het
Zfp644 T G 5: 106,782,909 (GRCm39) E1155A probably benign Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAATGTGTGCTCAAACATGTGAC -3'
(R):5'- GCCTGCCTGCATGACATACTGAAAC -3'

Sequencing Primer
(F):5'- GAACATTTGCCTTAGACAGACTC -3'
(R):5'- CATGACATACTGAAACTGGGAAGTG -3'
Posted On 2013-05-09