Mutagenetix > Incidental Mutation

Incidental Mutation 'R0012:Tbx15'

32533

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

038307-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R0012 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 99352096 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 428 (T428A)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

probably benign
Transcript: ENSMUST00000029462
AA Change: T428A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: T428A

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Meta Mutation Damage Score

0.0593

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.7%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam33	A	T	2: 131,052,920	L687Q	probably damaging	Het
Adap1	A	G	5: 139,307,734		probably benign	Het
Add2	T	A	6: 86,098,628	V253E	probably damaging	Het
Agtr1a	A	T	13: 30,381,749	I266F	probably damaging	Het
Anxa9	A	G	3: 95,308,095		probably benign	Het
Arap2	G	A	5: 62,683,484	L680F	probably damaging	Het
Asna1	T	C	8: 85,025,096		probably benign	Het
Bnip3	A	G	7: 138,898,672		probably benign	Het
Brwd1	A	C	16: 96,059,652	S311R	probably damaging	Het
C2cd3	G	A	7: 100,418,522	V871M	possibly damaging	Het
Cacul1	A	G	19: 60,564,253	W145R	probably damaging	Het
Celf5	C	A	10: 81,469,512	V141L	probably damaging	Het
Cfap206	C	A	4: 34,714,519	L392F	possibly damaging	Het
Chd2	G	T	7: 73,455,519	T192K	probably damaging	Het
Chrna10	T	C	7: 102,115,057	N40S	possibly damaging	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clspn	T	A	4: 126,564,929		probably benign	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Col5a3	A	T	9: 20,777,108		probably benign	Het
Copb1	T	A	7: 114,237,408	K366N	probably damaging	Het
Cul9	G	A	17: 46,538,510	R570C	probably benign	Het
Cyp2c70	A	T	19: 40,187,243	L7Q	probably null	Het
Dock2	T	C	11: 34,783,795	E10G	possibly damaging	Het
Dpysl4	T	G	7: 139,097,883	I412S	probably benign	Het
Eaf2	T	A	16: 36,808,174		probably benign	Het
Fasl	T	C	1: 161,788,164	D41G	probably benign	Het
Fat2	A	G	11: 55,262,871	V3505A	probably benign	Het
Fbxo24	A	G	5: 137,621,994	F101S	probably damaging	Het
Fdft1	T	C	14: 63,177,698	I28M	probably benign	Het
Gcnt3	T	C	9: 70,034,085	I400M	probably benign	Het
Gpd2	T	A	2: 57,338,868	M228K	probably damaging	Het
Gsap	T	A	5: 21,226,229		probably benign	Het
Hipk1	A	G	3: 103,763,680	M467T	probably damaging	Het
Hmgb4	T	A	4: 128,260,725	I17F	probably damaging	Het
Ints10	C	A	8: 68,807,475	L284M	probably benign	Het
Kif17	T	G	4: 138,293,748	S606A	probably damaging	Het
Lifr	C	A	15: 7,175,608	T442K	possibly damaging	Het
Lypd4	A	G	7: 24,865,332	L127P	probably damaging	Het
Lyst	A	G	13: 13,687,694	H2605R	probably benign	Het
Map3k4	A	G	17: 12,238,189	S1289P	probably damaging	Het
Mgam	T	A	6: 40,765,256		probably null	Het
Mob1b	G	A	5: 88,756,084		probably benign	Het
Mrgpra1	A	G	7: 47,335,470	S154P	probably damaging	Het
Ms4a4c	C	A	19: 11,418,980		probably benign	Het
Mthfd2l	A	T	5: 90,961,383	H224L	probably damaging	Het
Myh8	T	C	11: 67,300,021	Y1350H	probably benign	Het
Nectin2	T	C	7: 19,730,744		probably benign	Het
Nos1	A	C	5: 117,893,902	N305T	probably damaging	Het
Ogfrl1	T	A	1: 23,370,125	Q340L	possibly damaging	Het
Olfr1318	A	T	2: 112,156,826	N292Y	possibly damaging	Het
Olfr1502	C	A	19: 13,861,823	T10K	probably damaging	Het
Olfr170	T	C	16: 19,606,440	N76S	probably benign	Het
Olfr427	T	G	1: 174,100,207	F250V	probably damaging	Het
Orc1	T	C	4: 108,595,646		probably null	Het
Plekhg5	C	A	4: 152,104,750	D249E	probably benign	Het
Plet1	A	G	9: 50,499,130	I74V	probably benign	Het
Psmd2	T	A	16: 20,661,684	D718E	probably damaging	Het
Rab33b	G	T	3: 51,484,316		probably benign	Het
Rae1	T	A	2: 173,002,673	F4I	unknown	Het
Ralgapa2	A	G	2: 146,412,752	Y821H	probably benign	Het
Scd2	G	A	19: 44,301,246	V227I	probably benign	Het
Sharpin	G	T	15: 76,348,343	P156T	possibly damaging	Het
Slc38a4	C	T	15: 96,999,629	R435H	probably damaging	Het
Snrnp200	T	C	2: 127,228,549	V1061A	probably benign	Het
Suclg1	A	G	6: 73,270,997	T234A	possibly damaging	Het
Swsap1	T	C	9: 21,957,022	C197R	probably benign	Het
Tet2	T	C	3: 133,476,558	Y1215C	probably damaging	Het
Tjp1	A	G	7: 65,329,775		probably benign	Het
Tmem209	G	T	6: 30,502,113		probably benign	Het
Tnpo3	T	C	6: 29,589,177	E58G	probably damaging	Het
Trp53bp2	T	A	1: 182,444,718	M464K	probably damaging	Het
Ttc32	A	G	12: 9,035,897	Y148C	possibly damaging	Het
Unc80	T	C	1: 66,507,391	S541P	probably damaging	Het
Ushbp1	T	C	8: 71,395,040		probably benign	Het
Vmn2r100	A	G	17: 19,504,874	M22V	probably benign	Het
Vmn2r100	A	T	17: 19,526,034	E485V	probably damaging	Het
Wdr24	G	A	17: 25,827,113	V471I	probably benign	Het
Zfp35	T	A	18: 24,002,944	M115K	probably benign	Het
Zfp429	G	A	13: 67,390,677	S216L	probably benign	Het
Zfp644	T	G	5: 106,635,043	E1155A	probably benign	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAATGTGTGCTCAAACATGTGAC -3'
(R):5'- GCCTGCCTGCATGACATACTGAAAC -3'

Sequencing Primer
(F):5'- GAACATTTGCCTTAGACAGACTC -3'
(R):5'- CATGACATACTGAAACTGGGAAGTG -3'

Posted On

2013-05-09