Incidental Mutation 'R4381:Ighv1-62-1'
ID325342
Institutional Source Beutler Lab
Gene Symbol Ighv1-62-1
Ensembl Gene ENSMUSG00000102313
Gene Nameimmunoglobulin heavy variable 1-62-1
SynonymsGm9232
MMRRC Submission 041122-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R4381 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location115386697-115387128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115386993 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 18 (H18L)
Ref Sequence ENSEMBL: ENSMUSP00000100284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103503] [ENSMUST00000171270]
Predicted Effect probably benign
Transcript: ENSMUST00000103503
AA Change: H18L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100284
Gene: ENSMUSG00000102313
AA Change: H18L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 116 4.4e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193799
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Dlgap2 A G 8: 14,846,502 I993V probably benign Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Eml5 A G 12: 98,815,955 I1359T possibly damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
Gpr158 T A 2: 21,827,592 W1168R probably damaging Het
Il18r1 A G 1: 40,471,790 I12V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mib2 G C 4: 155,657,612 A234G possibly damaging Het
Mtpap T C 18: 4,383,223 F200S probably benign Het
Nacad T A 11: 6,600,204 T996S probably benign Het
Nek9 T A 12: 85,329,858 T250S probably damaging Het
Nif3l1 A C 1: 58,455,579 probably benign Het
Nipbl A G 15: 8,359,206 V310A probably benign Het
Olfr119 G T 17: 37,700,899 E76D probably damaging Het
Olfr854 A G 9: 19,566,742 L211P probably benign Het
Pbrm1 T C 14: 31,025,556 V33A probably benign Het
Pcdha4 A G 18: 36,952,875 E37G probably damaging Het
Pdgfc A G 3: 81,209,251 K304R probably damaging Het
Peak1 G T 9: 56,258,427 A739E probably benign Het
Pla2g4c A T 7: 13,346,065 N433Y probably damaging Het
Polrmt A C 10: 79,741,808 L319R possibly damaging Het
Prkaa1 A T 15: 5,176,808 T373S probably benign Het
Qars G A 9: 108,510,183 probably benign Het
Ranbp1 G A 16: 18,247,344 L33F probably damaging Het
Rpgrip1 C T 14: 52,150,449 P1094L possibly damaging Het
Taf1d T A 9: 15,311,981 probably benign Het
Tstd2 T C 4: 46,119,933 K340E probably benign Het
Vmn2r45 A T 7: 8,471,913 C705* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zdhhc16 A G 19: 41,940,654 Y232C possibly damaging Het
Zfp1 T A 8: 111,670,451 L354Q probably damaging Het
Zyg11a G A 4: 108,201,320 A341V possibly damaging Het
Other mutations in Ighv1-62-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2571:Ighv1-62-1 UTSW 12 115386757 missense probably damaging 0.99
R6670:Ighv1-62-1 UTSW 12 115386909 missense probably damaging 1.00
R6730:Ighv1-62-1 UTSW 12 115386892 missense probably benign 0.01
R7241:Ighv1-62-1 UTSW 12 115386702 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGTCAATGTGGCCTTGC -3'
(R):5'- GATCAGTGTCCTCTCCACAGTC -3'

Sequencing Primer
(F):5'- GGCCTTGCCCTTGAACTTC -3'
(R):5'- GTCCCTGCACACACTGACTC -3'
Posted On2015-07-06