Mutagenetix > Incidental Mutation

Incidental Mutation 'R4381:Nipbl'

325346

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4921518A06Rik, 4933421G18Rik

MMRRC Submission

041122-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R4381 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8290617-8444463 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8359206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 310 (V310A)

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000052965
AA Change: V310A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: V310A

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Meta Mutation Damage Score

0.0583

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

95% (41/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk1	C	T	3: 127,729,373	V7M	probably damaging	Het
Dlgap2	A	G	8: 14,846,502	I993V	probably benign	Het
Dst	T	C	1: 34,163,235	S215P	probably damaging	Het
Eml5	A	G	12: 98,815,955	I1359T	possibly damaging	Het
Eps15	G	A	4: 109,366,530		probably benign	Het
Gpr158	T	A	2: 21,827,592	W1168R	probably damaging	Het
Ighv1-62-1	T	A	12: 115,386,993	H18L	probably benign	Het
Il18r1	A	G	1: 40,471,790	I12V	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Mib2	G	C	4: 155,657,612	A234G	possibly damaging	Het
Mtpap	T	C	18: 4,383,223	F200S	probably benign	Het
Nacad	T	A	11: 6,600,204	T996S	probably benign	Het
Nek9	T	A	12: 85,329,858	T250S	probably damaging	Het
Nif3l1	A	C	1: 58,455,579		probably benign	Het
Olfr119	G	T	17: 37,700,899	E76D	probably damaging	Het
Olfr854	A	G	9: 19,566,742	L211P	probably benign	Het
Pbrm1	T	C	14: 31,025,556	V33A	probably benign	Het
Pcdha4	A	G	18: 36,952,875	E37G	probably damaging	Het
Pdgfc	A	G	3: 81,209,251	K304R	probably damaging	Het
Peak1	G	T	9: 56,258,427	A739E	probably benign	Het
Pla2g4c	A	T	7: 13,346,065	N433Y	probably damaging	Het
Polrmt	A	C	10: 79,741,808	L319R	possibly damaging	Het
Prkaa1	A	T	15: 5,176,808	T373S	probably benign	Het
Qars	G	A	9: 108,510,183		probably benign	Het
Ranbp1	G	A	16: 18,247,344	L33F	probably damaging	Het
Rpgrip1	C	T	14: 52,150,449	P1094L	possibly damaging	Het
Taf1d	T	A	9: 15,311,981		probably benign	Het
Tstd2	T	C	4: 46,119,933	K340E	probably benign	Het
Vmn2r45	A	T	7: 8,471,913	C705*	probably null	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Zdhhc16	A	G	19: 41,940,654	Y232C	possibly damaging	Het
Zfp1	T	A	8: 111,670,451	L354Q	probably damaging	Het
Zyg11a	G	A	4: 108,201,320	A341V	possibly damaging	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8366673	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8369474	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8296869	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8350455	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8350497	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8311209	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8350539	missense	probably benign
IGL01723:Nipbl	APN	15	8335071	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8361821	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8327090	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8359074	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8343574	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8323647	splice site	probably null
IGL02547:Nipbl	APN	15	8351598	missense	probably benign
IGL02678:Nipbl	APN	15	8351110	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8295553	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8350314	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8332452	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8338979	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8293085	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8350876	missense	probably benign	0.12
R0346_Nipbl_297	UTSW	15	8360956	missense	probably damaging	0.99
R0347_Nipbl_476	UTSW	15	8350732	missense	probably benign
R3620_nipbl_616	UTSW	15	8333024	missense	probably damaging	0.99
R6388_Nipbl_651	UTSW	15	8300784	missense	probably damaging	0.99
R8441_Nipbl_224	UTSW	15	8293115	missense	probably benign	0.00
R0271:Nipbl	UTSW	15	8361737	missense	possibly damaging	0.76
R0346:Nipbl	UTSW	15	8360956	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8350732	missense	probably benign
R0422:Nipbl	UTSW	15	8351628	missense	probably benign
R0486:Nipbl	UTSW	15	8338870	splice site	probably benign
R0652:Nipbl	UTSW	15	8303480	missense	probably benign	0.23
R0667:Nipbl	UTSW	15	8361004	missense	possibly damaging	0.86
R0689:Nipbl	UTSW	15	8293078	splice site	probably null
R0726:Nipbl	UTSW	15	8351555	missense	probably benign
R0881:Nipbl	UTSW	15	8307612	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8361718	missense	probably benign
R0969:Nipbl	UTSW	15	8292228	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8372173	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8350289	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8351280	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8366664	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8302912	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8338551	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8319488	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8343517	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8327132	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8343630	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8343630	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8350287	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8324467	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8311207	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8336919	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8293218	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8351482	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8335006	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8323698	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8311239	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8343592	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8333024	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8295661	missense	probably damaging	0.97
R3745:Nipbl	UTSW	15	8358874	missense	probably benign
R3902:Nipbl	UTSW	15	8350246	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8350534	missense	probably benign
R4164:Nipbl	UTSW	15	8338934	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8332432	missense	probably damaging	1.00
R4394:Nipbl	UTSW	15	8361861	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8338724	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8366658	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8366658	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8302984	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8365829	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8351497	missense	probably benign
R5428:Nipbl	UTSW	15	8330296	missense	probably benign	0.00
R5641:Nipbl	UTSW	15	8366712	missense	possibly damaging	0.93
R5643:Nipbl	UTSW	15	8358907	missense	probably benign
R5644:Nipbl	UTSW	15	8358907	missense	probably benign
R5681:Nipbl	UTSW	15	8301382	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8324649	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8334844	splice site	probably null
R5970:Nipbl	UTSW	15	8296818	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8324264	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8295568	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8334906	missense	probably damaging	1.00
R6216:Nipbl	UTSW	15	8318383	missense	probably damaging	0.99
R6236:Nipbl	UTSW	15	8324580	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8300895	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8300895	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8300784	missense	probably damaging	0.99
R6427:Nipbl	UTSW	15	8351565	missense	probably benign
R6707:Nipbl	UTSW	15	8324559	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8322590	missense	probably damaging	1.00
R6921:Nipbl	UTSW	15	8303485	missense	probably benign	0.28
R7239:Nipbl	UTSW	15	8292135	critical splice donor site	probably null
R7346:Nipbl	UTSW	15	8343606	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8330295	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8295636	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8343493	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8305872	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8293101	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8351526	missense	probably benign	0.01
R7760:Nipbl	UTSW	15	8358702	missense	probably damaging	1.00
R7766:Nipbl	UTSW	15	8296849	missense	probably benign	0.45
R7825:Nipbl	UTSW	15	8291487	missense	probably damaging	1.00
R7862:Nipbl	UTSW	15	8325752	missense	probably benign	0.06
R7958:Nipbl	UTSW	15	8311258	missense	possibly damaging	0.91
R8077:Nipbl	UTSW	15	8311250	missense	possibly damaging	0.49
R8119:Nipbl	UTSW	15	8359212	missense	probably benign	0.22
R8355:Nipbl	UTSW	15	8335044	missense	probably damaging	0.98
R8441:Nipbl	UTSW	15	8293115	missense	probably benign	0.00
R8455:Nipbl	UTSW	15	8335044	missense	probably damaging	0.98
R8717:Nipbl	UTSW	15	8338741	missense	probably benign
R8739:Nipbl	UTSW	15	8303420	missense	probably benign	0.08
R8854:Nipbl	UTSW	15	8300726	missense	probably damaging	1.00
R8887:Nipbl	UTSW	15	8361787	missense	probably damaging	1.00
R8942:Nipbl	UTSW	15	8351620	missense	probably benign
R8991:Nipbl	UTSW	15	8291513	missense	probably damaging	1.00
R9008:Nipbl	UTSW	15	8327124	missense	probably damaging	1.00
R9070:Nipbl	UTSW	15	8338731	missense	possibly damaging	0.82
R9116:Nipbl	UTSW	15	8350856	missense	probably benign	0.00
R9622:Nipbl	UTSW	15	8336889	missense	probably benign	0.27
R9778:Nipbl	UTSW	15	8291548	missense	probably benign	0.10
RF020:Nipbl	UTSW	15	8358934	missense	probably damaging	0.98
X0022:Nipbl	UTSW	15	8351715	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8323537	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8307882	missense	probably damaging	1.00
Z1176:Nipbl	UTSW	15	8338699	missense	possibly damaging	0.88
Z1177:Nipbl	UTSW	15	8336952	missense	probably damaging	1.00
Z1177:Nipbl	UTSW	15	8338680	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTCTGTCCTGGATACTGCAC -3'
(R):5'- AGTTCCAAAGTACCTTGGACTAGATG -3'

Sequencing Primer
(F):5'- ACCAGATAGCATATCGTCTTGCTGG -3'
(R):5'- CAAAGTACCTTGGACTAGATGATTTC -3'

Posted On

2015-07-06