Incidental Mutation 'R4381:Ranbp1'
ID325347
Institutional Source Beutler Lab
Gene Symbol Ranbp1
Ensembl Gene ENSMUSG00000005732
Gene NameRAN binding protein 1
SynonymsHtf9a
MMRRC Submission 041122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4381 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18239784-18248732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18247344 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 33 (L33F)
Ref Sequence ENSEMBL: ENSMUSP00000111309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052325] [ENSMUST00000100099] [ENSMUST00000115640] [ENSMUST00000115645] [ENSMUST00000128045] [ENSMUST00000140206] [ENSMUST00000231509]
Predicted Effect probably benign
Transcript: ENSMUST00000052325
SMART Domains Protein: ENSMUSP00000055288
Gene: ENSMUSG00000005732

DomainStartEndE-ValueType
RanBD 1 108 4.92e-46 SMART
coiled coil region 123 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059696
Predicted Effect probably benign
Transcript: ENSMUST00000100099
SMART Domains Protein: ENSMUSP00000111303
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 1.2e-20 PFAM
Pfam:PCMT 386 482 1.1e-8 PFAM
Pfam:MTS 389 489 6.2e-9 PFAM
Pfam:Methyltransf_4 397 497 4.2e-7 PFAM
Pfam:Methyltransf_31 420 546 6.2e-15 PFAM
Pfam:Methyltransf_18 422 523 9.3e-11 PFAM
Pfam:Methyltransf_26 423 538 5.3e-12 PFAM
Pfam:Methyltransf_25 426 511 3.5e-8 PFAM
Pfam:Methyltransf_11 427 487 5.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115640
SMART Domains Protein: ENSMUSP00000111304
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 2.6e-20 PFAM
Pfam:PCMT 386 482 3.4e-9 PFAM
Pfam:MTS 392 489 1e-7 PFAM
Pfam:Cons_hypoth95 405 542 2.7e-7 PFAM
Pfam:Methyltransf_31 420 547 2.1e-15 PFAM
Pfam:Methyltransf_18 422 526 2.9e-12 PFAM
Pfam:Methyltransf_4 423 499 2.6e-7 PFAM
Pfam:Methyltransf_25 426 511 1.3e-8 PFAM
Pfam:Methyltransf_11 427 489 3.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115645
AA Change: L33F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111309
Gene: ENSMUSG00000005732
AA Change: L33F

DomainStartEndE-ValueType
RanBD 27 158 3.33e-75 SMART
low complexity region 183 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127239
Predicted Effect probably benign
Transcript: ENSMUST00000128045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134035
Predicted Effect probably benign
Transcript: ENSMUST00000140206
SMART Domains Protein: ENSMUSP00000121216
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 383 481 3.7e-8 PFAM
Pfam:PCMT 386 481 1.5e-6 PFAM
Pfam:MTS 389 493 2.5e-7 PFAM
Pfam:Methyltransf_31 420 491 1.5e-9 PFAM
Pfam:Methyltransf_18 422 508 4.1e-8 PFAM
Pfam:Methyltransf_26 423 523 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145112
SMART Domains Protein: ENSMUSP00000117026
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
Pfam:PCMT 118 220 4.2e-7 PFAM
Pfam:tRNA_U5-meth_tr 118 280 4e-16 PFAM
Pfam:MTS 129 229 5.4e-6 PFAM
Pfam:Cons_hypoth95 143 277 6.5e-5 PFAM
Pfam:PrmA 146 234 2e-4 PFAM
Pfam:Ubie_methyltran 148 223 1e-4 PFAM
Pfam:Methyltransf_31 158 271 6.1e-14 PFAM
Pfam:Methyltransf_18 160 263 8.3e-11 PFAM
Pfam:Methyltransf_4 161 237 7.1e-5 PFAM
Pfam:Methyltransf_26 161 274 2e-6 PFAM
Pfam:Methyltransf_25 164 251 5.2e-7 PFAM
Pfam:Methyltransf_11 165 227 9.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153292
Predicted Effect probably benign
Transcript: ENSMUST00000231509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232342
Predicted Effect probably benign
Transcript: ENSMUST00000232293
Predicted Effect probably benign
Transcript: ENSMUST00000232144
Meta Mutation Damage Score 0.3599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms a complex with Ras-related nuclear protein (Ran) and metabolizes guanoside triphosphate (GTP). This complex participates in the regulation of the cell cycle by controlling transport of proteins and nucleic acids into the nucleus. There are multiple pseudogenes for this gene on chromosomes 9, 12, 17, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal growth retardation, decreased body weight, impaired spermatogenesis, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Dlgap2 A G 8: 14,846,502 I993V probably benign Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Eml5 A G 12: 98,815,955 I1359T possibly damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
Gpr158 T A 2: 21,827,592 W1168R probably damaging Het
Ighv1-62-1 T A 12: 115,386,993 H18L probably benign Het
Il18r1 A G 1: 40,471,790 I12V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mib2 G C 4: 155,657,612 A234G possibly damaging Het
Mtpap T C 18: 4,383,223 F200S probably benign Het
Nacad T A 11: 6,600,204 T996S probably benign Het
Nek9 T A 12: 85,329,858 T250S probably damaging Het
Nif3l1 A C 1: 58,455,579 probably benign Het
Nipbl A G 15: 8,359,206 V310A probably benign Het
Olfr119 G T 17: 37,700,899 E76D probably damaging Het
Olfr854 A G 9: 19,566,742 L211P probably benign Het
Pbrm1 T C 14: 31,025,556 V33A probably benign Het
Pcdha4 A G 18: 36,952,875 E37G probably damaging Het
Pdgfc A G 3: 81,209,251 K304R probably damaging Het
Peak1 G T 9: 56,258,427 A739E probably benign Het
Pla2g4c A T 7: 13,346,065 N433Y probably damaging Het
Polrmt A C 10: 79,741,808 L319R possibly damaging Het
Prkaa1 A T 15: 5,176,808 T373S probably benign Het
Qars G A 9: 108,510,183 probably benign Het
Rpgrip1 C T 14: 52,150,449 P1094L possibly damaging Het
Taf1d T A 9: 15,311,981 probably benign Het
Tstd2 T C 4: 46,119,933 K340E probably benign Het
Vmn2r45 A T 7: 8,471,913 C705* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zdhhc16 A G 19: 41,940,654 Y232C possibly damaging Het
Zfp1 T A 8: 111,670,451 L354Q probably damaging Het
Zyg11a G A 4: 108,201,320 A341V possibly damaging Het
Other mutations in Ranbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03165:Ranbp1 APN 16 18247281 unclassified probably benign
R0189:Ranbp1 UTSW 16 18241743 critical splice donor site probably null
R0764:Ranbp1 UTSW 16 18240158 nonsense probably null
R3276:Ranbp1 UTSW 16 18247429 unclassified probably benign
R4620:Ranbp1 UTSW 16 18240104 unclassified probably benign
R5127:Ranbp1 UTSW 16 18247287 critical splice donor site probably null
R5655:Ranbp1 UTSW 16 18241805 missense probably damaging 1.00
R5965:Ranbp1 UTSW 16 18245228 missense probably damaging 0.97
R7080:Ranbp1 UTSW 16 18245233 missense possibly damaging 0.51
R7900:Ranbp1 UTSW 16 18245297 missense probably damaging 0.97
R8356:Ranbp1 UTSW 16 18245306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAAAGAGGCTATGCCAGAAC -3'
(R):5'- GCCAGCAACATCACTCTACCTTC -3'

Sequencing Primer
(F):5'- ACAAGGGACAGAATTCCTAG -3'
(R):5'- TCTCTACACAGGACAGTCAC -3'
Posted On2015-07-06