Incidental Mutation 'R4382:Gad2'
ID325355
Institutional Source Beutler Lab
Gene Symbol Gad2
Ensembl Gene ENSMUSG00000026787
Gene Nameglutamic acid decarboxylase 2
SynonymsGad-2, 6330404F12Rik, GAD(65), GAD65
MMRRC Submission 041679-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4382 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location22622205-22693874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22685410 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 509 (V509I)
Ref Sequence ENSEMBL: ENSMUSP00000028123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028123]
Predicted Effect probably benign
Transcript: ENSMUST00000028123
AA Change: V509I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028123
Gene: ENSMUSG00000026787
AA Change: V509I

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 138 509 7.8e-138 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit spontaneous (frequently fatal) seizures, increased anxiety-like behavior, and reduced intermale aggression. Heterozygotes show reduced aggressiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T C 2: 91,208,109 S309P possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
B4galnt4 T C 7: 141,070,536 V772A probably damaging Het
BC067074 T C 13: 113,322,754 I1273T probably benign Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Ccdc92b G A 11: 74,630,016 S48N probably damaging Het
Ceacam12 C T 7: 18,066,034 probably benign Het
Clca3a1 T A 3: 144,760,722 M1L probably benign Het
Cnot1 T C 8: 95,769,779 T300A probably damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Col6a6 G A 9: 105,783,690 R407W probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddx60 G A 8: 61,948,978 probably null Het
Dnajb12 A T 10: 59,897,499 K372N probably benign Het
Fhl5 A C 4: 25,200,118 C239G probably benign Het
Glrb T A 3: 80,879,639 R72S probably damaging Het
Gm13124 T A 4: 144,555,026 T399S possibly damaging Het
Gm6811 T C 17: 21,094,603 noncoding transcript Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hk2 A T 6: 82,735,341 L542Q probably null Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kel T A 6: 41,698,400 T306S probably benign Het
Lpo T C 11: 87,822,201 D25G probably benign Het
Mboat7 T A 7: 3,688,546 Y109F possibly damaging Het
Myh15 T G 16: 49,142,943 N1082K probably benign Het
Nagk A G 6: 83,798,011 E90G probably benign Het
Nagpa A T 16: 5,203,955 F10I possibly damaging Het
Olfr460 T A 6: 40,572,064 L226H probably damaging Het
Otog T A 7: 46,289,698 C2051S probably damaging Het
Ptpn6 A G 6: 124,727,398 V315A possibly damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rnf41 T C 10: 128,436,523 S140P probably benign Het
Ros1 C T 10: 52,120,959 V1206I possibly damaging Het
Scgb2b12 T A 7: 32,325,445 E112D probably benign Het
Serpinb3b T A 1: 107,155,543 M210L probably damaging Het
Sipa1l1 A G 12: 82,446,822 R1672G possibly damaging Het
Smc5 A G 19: 23,268,846 S70P probably benign Het
Spen C T 4: 141,473,139 G2703S possibly damaging Het
Stard9 C G 2: 120,634,222 A56G probably damaging Het
Wtap A G 17: 12,975,420 S87P probably damaging Het
Zzef1 T G 11: 72,875,112 S1488R probably benign Het
Other mutations in Gad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Gad2 APN 2 22685386 missense probably benign 0.07
IGL00870:Gad2 APN 2 22629971 missense probably benign 0.42
IGL01142:Gad2 APN 2 22681285 splice site probably benign
IGL01577:Gad2 APN 2 22681280 splice site probably benign
IGL01671:Gad2 APN 2 22623699 nonsense probably null
IGL02346:Gad2 APN 2 22629939 splice site probably benign
IGL02348:Gad2 APN 2 22629393 missense probably damaging 1.00
IGL03113:Gad2 APN 2 22681355 missense probably benign 0.09
gruene UTSW 2 22685067 critical splice donor site probably null
Mosey UTSW 2 22668257 missense probably damaging 1.00
R0630:Gad2 UTSW 2 22690336 missense probably benign 0.14
R1109:Gad2 UTSW 2 22681394 missense probably damaging 1.00
R1109:Gad2 UTSW 2 22690159 splice site probably benign
R1122:Gad2 UTSW 2 22623451 missense possibly damaging 0.68
R1604:Gad2 UTSW 2 22623840 critical splice donor site probably null
R1773:Gad2 UTSW 2 22690207 missense probably benign
R1895:Gad2 UTSW 2 22685428 missense probably benign
R1946:Gad2 UTSW 2 22685428 missense probably benign
R2329:Gad2 UTSW 2 22668289 missense probably damaging 1.00
R2857:Gad2 UTSW 2 22673975 missense probably benign 0.02
R3754:Gad2 UTSW 2 22681340 missense possibly damaging 0.91
R3847:Gad2 UTSW 2 22684988 missense probably benign 0.00
R4383:Gad2 UTSW 2 22685410 missense probably benign
R4384:Gad2 UTSW 2 22685410 missense probably benign
R4651:Gad2 UTSW 2 22668362 missense probably damaging 1.00
R4700:Gad2 UTSW 2 22673970 missense probably damaging 1.00
R4766:Gad2 UTSW 2 22622667 missense probably damaging 0.99
R5279:Gad2 UTSW 2 22673957 missense probably benign 0.38
R5372:Gad2 UTSW 2 22690243 missense possibly damaging 0.84
R5505:Gad2 UTSW 2 22624833 missense probably benign
R5820:Gad2 UTSW 2 22690249 missense probably benign 0.00
R5868:Gad2 UTSW 2 22685067 critical splice donor site probably null
R6026:Gad2 UTSW 2 22623736 missense probably benign 0.00
R6497:Gad2 UTSW 2 22668257 missense probably damaging 1.00
R6675:Gad2 UTSW 2 22673985 missense possibly damaging 0.67
R7157:Gad2 UTSW 2 22635023 missense probably damaging 0.98
R7352:Gad2 UTSW 2 22623823 missense probably benign 0.00
R7951:Gad2 UTSW 2 22623487 missense probably damaging 0.96
R8285:Gad2 UTSW 2 22624928 missense probably benign 0.45
X0019:Gad2 UTSW 2 22690172 critical splice acceptor site probably null
Z1177:Gad2 UTSW 2 22635014 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGGATAAAGAGTGGACTCAC -3'
(R):5'- AGGGGACAATGGCTTTGCAC -3'

Sequencing Primer
(F):5'- TGGACTCACAACTCTGAAGAATGTG -3'
(R):5'- ACAATGGCTTTGCACATCTGG -3'
Posted On2015-07-06