Incidental Mutation 'R4382:Spen'
ID 325362
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Name spen family transcription repressor
Synonyms Mint
MMRRC Submission 041679-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4382 (G1)
Quality Score 222
Status Not validated
Chromosome 4
Chromosomal Location 141467890-141538597 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 141473139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 2703 (G2703S)
Ref Sequence ENSEMBL: ENSMUSP00000077925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000078886
AA Change: G2703S

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: G2703S

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105786
AA Change: G2726S

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: G2726S

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147227
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T C 2: 91,208,109 (GRCm38) S309P possibly damaging Het
Adam23 T C 1: 63,566,628 (GRCm38) Y624H probably damaging Het
B4galnt4 T C 7: 141,070,536 (GRCm38) V772A probably damaging Het
BC067074 T C 13: 113,322,754 (GRCm38) I1273T probably benign Het
Boc A T 16: 44,491,182 (GRCm38) L726H probably damaging Het
Calr3 T A 8: 72,428,164 (GRCm38) D120V probably damaging Het
Ccdc92b G A 11: 74,630,016 (GRCm38) S48N probably damaging Het
Ceacam12 C T 7: 18,066,034 (GRCm38) probably benign Het
Clca3a1 T A 3: 144,760,722 (GRCm38) M1L probably benign Het
Cnot1 T C 8: 95,769,779 (GRCm38) T300A probably damaging Het
Col12a1 A T 9: 79,630,741 (GRCm38) Y2514* probably null Het
Col6a6 G A 9: 105,783,690 (GRCm38) R407W probably damaging Het
Csnk1g1 T C 9: 66,019,908 (GRCm38) V119A probably damaging Het
Ddx60 G A 8: 61,948,978 (GRCm38) probably null Het
Dnajb12 A T 10: 59,897,499 (GRCm38) K372N probably benign Het
Fhl5 A C 4: 25,200,118 (GRCm38) C239G probably benign Het
Gad2 G A 2: 22,685,410 (GRCm38) V509I probably benign Het
Glrb T A 3: 80,879,639 (GRCm38) R72S probably damaging Het
Gm13124 T A 4: 144,555,026 (GRCm38) T399S possibly damaging Het
Gm6811 T C 17: 21,094,603 (GRCm38) noncoding transcript Het
Hecw1 C T 13: 14,316,164 (GRCm38) D748N probably damaging Het
Hk2 A T 6: 82,735,341 (GRCm38) L542Q probably null Het
Iglc1 A T 16: 19,061,758 (GRCm38) C104* probably null Het
Kel T A 6: 41,698,400 (GRCm38) T306S probably benign Het
Lpo T C 11: 87,822,201 (GRCm38) D25G probably benign Het
Mboat7 T A 7: 3,688,546 (GRCm38) Y109F possibly damaging Het
Myh15 T G 16: 49,142,943 (GRCm38) N1082K probably benign Het
Nagk A G 6: 83,798,011 (GRCm38) E90G probably benign Het
Nagpa A T 16: 5,203,955 (GRCm38) F10I possibly damaging Het
Olfr460 T A 6: 40,572,064 (GRCm38) L226H probably damaging Het
Otog T A 7: 46,289,698 (GRCm38) C2051S probably damaging Het
Ptpn6 A G 6: 124,727,398 (GRCm38) V315A possibly damaging Het
Rbp3 G C 14: 33,955,296 (GRCm38) E400D probably benign Het
Rnf41 T C 10: 128,436,523 (GRCm38) S140P probably benign Het
Ros1 C T 10: 52,120,959 (GRCm38) V1206I possibly damaging Het
Scgb2b12 T A 7: 32,325,445 (GRCm38) E112D probably benign Het
Serpinb3b T A 1: 107,155,543 (GRCm38) M210L probably damaging Het
Sipa1l1 A G 12: 82,446,822 (GRCm38) R1672G possibly damaging Het
Smc5 A G 19: 23,268,846 (GRCm38) S70P probably benign Het
Stard9 C G 2: 120,634,222 (GRCm38) A56G probably damaging Het
Wtap A G 17: 12,975,420 (GRCm38) S87P probably damaging Het
Zzef1 T G 11: 72,875,112 (GRCm38) S1488R probably benign Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141,489,901 (GRCm38) missense unknown
IGL01357:Spen APN 4 141,517,113 (GRCm38) missense unknown
IGL02184:Spen APN 4 141,487,606 (GRCm38) missense unknown
IGL02226:Spen APN 4 141,478,146 (GRCm38) missense unknown
IGL02321:Spen APN 4 141,517,130 (GRCm38) missense unknown
IGL02350:Spen APN 4 141,477,579 (GRCm38) missense unknown
IGL02357:Spen APN 4 141,477,579 (GRCm38) missense unknown
IGL02627:Spen APN 4 141,473,015 (GRCm38) missense probably damaging 0.99
IGL02683:Spen APN 4 141,471,645 (GRCm38) missense probably benign 0.06
IGL02945:Spen APN 4 141,494,313 (GRCm38) missense unknown
IGL02950:Spen APN 4 141,469,508 (GRCm38) missense probably damaging 1.00
IGL03008:Spen APN 4 141,476,137 (GRCm38) missense possibly damaging 0.70
IGL03019:Spen APN 4 141,478,916 (GRCm38) missense unknown
IGL03038:Spen APN 4 141,538,239 (GRCm38) missense unknown
IGL03334:Spen APN 4 141,469,969 (GRCm38) missense probably damaging 1.00
filtered UTSW 4 141,477,372 (GRCm38) missense unknown
mentholated UTSW 4 141,469,400 (GRCm38) missense possibly damaging 0.78
R0105:Spen UTSW 4 141,469,810 (GRCm38) splice site probably benign
R0268:Spen UTSW 4 141,477,557 (GRCm38) missense unknown
R0359:Spen UTSW 4 141,516,870 (GRCm38) missense unknown
R0394:Spen UTSW 4 141,474,203 (GRCm38) missense probably benign 0.03
R0423:Spen UTSW 4 141,479,336 (GRCm38) missense unknown
R0433:Spen UTSW 4 141,483,758 (GRCm38) missense unknown
R0462:Spen UTSW 4 141,473,651 (GRCm38) missense probably damaging 1.00
R0687:Spen UTSW 4 141,488,028 (GRCm38) missense unknown
R0699:Spen UTSW 4 141,474,391 (GRCm38) missense possibly damaging 0.72
R0865:Spen UTSW 4 141,471,870 (GRCm38) missense probably benign 0.11
R0918:Spen UTSW 4 141,485,564 (GRCm38) missense unknown
R1034:Spen UTSW 4 141,475,752 (GRCm38) missense probably benign 0.33
R1341:Spen UTSW 4 141,469,400 (GRCm38) missense possibly damaging 0.78
R1401:Spen UTSW 4 141,471,821 (GRCm38) missense probably damaging 0.98
R1509:Spen UTSW 4 141,475,635 (GRCm38) missense probably benign 0.00
R1509:Spen UTSW 4 141,475,700 (GRCm38) missense possibly damaging 0.53
R1561:Spen UTSW 4 141,472,383 (GRCm38) nonsense probably null
R1589:Spen UTSW 4 141,488,024 (GRCm38) missense unknown
R1640:Spen UTSW 4 141,468,943 (GRCm38) missense probably damaging 0.98
R1758:Spen UTSW 4 141,476,375 (GRCm38) missense unknown
R1764:Spen UTSW 4 141,472,950 (GRCm38) missense probably damaging 1.00
R1824:Spen UTSW 4 141,472,785 (GRCm38) missense probably damaging 1.00
R1899:Spen UTSW 4 141,470,343 (GRCm38) missense probably benign 0.17
R1916:Spen UTSW 4 141,472,598 (GRCm38) missense probably damaging 1.00
R2011:Spen UTSW 4 141,473,329 (GRCm38) missense probably damaging 1.00
R2295:Spen UTSW 4 141,477,273 (GRCm38) missense unknown
R2379:Spen UTSW 4 141,516,927 (GRCm38) missense unknown
R2404:Spen UTSW 4 141,477,905 (GRCm38) missense unknown
R3719:Spen UTSW 4 141,517,183 (GRCm38) missense unknown
R3889:Spen UTSW 4 141,477,881 (GRCm38) missense unknown
R3945:Spen UTSW 4 141,477,353 (GRCm38) missense unknown
R4227:Spen UTSW 4 141,522,147 (GRCm38) missense unknown
R4326:Spen UTSW 4 141,477,372 (GRCm38) missense unknown
R4542:Spen UTSW 4 141,476,786 (GRCm38) missense unknown
R4757:Spen UTSW 4 141,473,079 (GRCm38) nonsense probably null
R4771:Spen UTSW 4 141,472,596 (GRCm38) missense probably benign 0.14
R5072:Spen UTSW 4 141,522,302 (GRCm38) missense unknown
R5121:Spen UTSW 4 141,476,099 (GRCm38) missense probably benign 0.00
R5176:Spen UTSW 4 141,476,276 (GRCm38) missense unknown
R5290:Spen UTSW 4 141,473,816 (GRCm38) missense probably damaging 1.00
R5291:Spen UTSW 4 141,488,079 (GRCm38) missense unknown
R5293:Spen UTSW 4 141,472,406 (GRCm38) missense possibly damaging 0.89
R5347:Spen UTSW 4 141,471,485 (GRCm38) missense probably benign 0.26
R5511:Spen UTSW 4 141,516,838 (GRCm38) missense unknown
R5511:Spen UTSW 4 141,475,064 (GRCm38) missense possibly damaging 0.86
R5772:Spen UTSW 4 141,478,184 (GRCm38) missense unknown
R5834:Spen UTSW 4 141,471,843 (GRCm38) missense possibly damaging 0.63
R5858:Spen UTSW 4 141,473,871 (GRCm38) missense probably benign 0.05
R6214:Spen UTSW 4 141,479,112 (GRCm38) missense unknown
R6232:Spen UTSW 4 141,517,022 (GRCm38) missense unknown
R6345:Spen UTSW 4 141,471,633 (GRCm38) missense possibly damaging 0.86
R6419:Spen UTSW 4 141,476,310 (GRCm38) missense unknown
R6455:Spen UTSW 4 141,475,509 (GRCm38) missense probably damaging 0.97
R6979:Spen UTSW 4 141,478,063 (GRCm38) missense unknown
R6994:Spen UTSW 4 141,493,459 (GRCm38) missense unknown
R7018:Spen UTSW 4 141,493,444 (GRCm38) missense unknown
R7040:Spen UTSW 4 141,494,382 (GRCm38) missense unknown
R7127:Spen UTSW 4 141,476,108 (GRCm38) missense possibly damaging 0.53
R7218:Spen UTSW 4 141,472,650 (GRCm38) missense possibly damaging 0.54
R7234:Spen UTSW 4 141,479,135 (GRCm38) missense unknown
R7316:Spen UTSW 4 141,477,054 (GRCm38) missense unknown
R7350:Spen UTSW 4 141,479,385 (GRCm38) missense unknown
R7356:Spen UTSW 4 141,471,924 (GRCm38) nonsense probably null
R7400:Spen UTSW 4 141,473,741 (GRCm38) missense probably damaging 1.00
R7470:Spen UTSW 4 141,479,294 (GRCm38) missense unknown
R7698:Spen UTSW 4 141,472,845 (GRCm38) missense probably damaging 1.00
R7858:Spen UTSW 4 141,488,131 (GRCm38) splice site probably null
R8033:Spen UTSW 4 141,471,746 (GRCm38) missense probably benign 0.03
R8064:Spen UTSW 4 141,475,700 (GRCm38) missense possibly damaging 0.53
R8159:Spen UTSW 4 141,475,003 (GRCm38) missense possibly damaging 0.53
R8187:Spen UTSW 4 141,472,905 (GRCm38) missense possibly damaging 0.93
R8463:Spen UTSW 4 141,522,279 (GRCm38) missense unknown
R8557:Spen UTSW 4 141,470,370 (GRCm38) missense probably benign 0.14
R8558:Spen UTSW 4 141,470,370 (GRCm38) missense probably benign 0.14
R8672:Spen UTSW 4 141,470,370 (GRCm38) missense probably benign 0.14
R8673:Spen UTSW 4 141,470,370 (GRCm38) missense probably benign 0.14
R8674:Spen UTSW 4 141,470,370 (GRCm38) missense probably benign 0.14
R8714:Spen UTSW 4 141,488,003 (GRCm38) missense unknown
R8735:Spen UTSW 4 141,469,818 (GRCm38) missense probably benign 0.32
R8762:Spen UTSW 4 141,472,950 (GRCm38) missense probably damaging 1.00
R8877:Spen UTSW 4 141,471,826 (GRCm38) nonsense probably null
R8878:Spen UTSW 4 141,477,209 (GRCm38) missense unknown
R8937:Spen UTSW 4 141,474,063 (GRCm38) missense probably damaging 1.00
R8939:Spen UTSW 4 141,475,658 (GRCm38) missense possibly damaging 0.72
R8968:Spen UTSW 4 141,470,390 (GRCm38) missense probably benign 0.02
R8971:Spen UTSW 4 141,474,578 (GRCm38) missense possibly damaging 0.53
R9016:Spen UTSW 4 141,473,627 (GRCm38) missense probably damaging 1.00
R9072:Spen UTSW 4 141,476,391 (GRCm38) missense unknown
R9073:Spen UTSW 4 141,476,391 (GRCm38) missense unknown
R9120:Spen UTSW 4 141,472,922 (GRCm38) missense
R9136:Spen UTSW 4 141,522,312 (GRCm38) missense unknown
R9138:Spen UTSW 4 141,469,486 (GRCm38) missense probably damaging 1.00
R9150:Spen UTSW 4 141,517,157 (GRCm38) missense unknown
R9225:Spen UTSW 4 141,475,632 (GRCm38) missense possibly damaging 0.53
R9492:Spen UTSW 4 141,471,787 (GRCm38) missense probably benign 0.26
R9537:Spen UTSW 4 141,516,845 (GRCm38) small deletion probably benign
R9537:Spen UTSW 4 141,471,704 (GRCm38) missense probably benign 0.15
R9602:Spen UTSW 4 141,477,872 (GRCm38) missense unknown
R9609:Spen UTSW 4 141,488,108 (GRCm38) missense unknown
R9686:Spen UTSW 4 141,472,635 (GRCm38) missense probably benign 0.27
R9697:Spen UTSW 4 141,468,964 (GRCm38) missense probably damaging 1.00
R9713:Spen UTSW 4 141,517,020 (GRCm38) missense unknown
T0722:Spen UTSW 4 141,474,353 (GRCm38) missense probably benign 0.33
T0975:Spen UTSW 4 141,474,353 (GRCm38) missense probably benign 0.33
Z1088:Spen UTSW 4 141,477,976 (GRCm38) missense unknown
Z1088:Spen UTSW 4 141,477,977 (GRCm38) missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTGATGTATTCACCCGCAGC -3'
(R):5'- TGGTGAATGTCTCTCTGGTCCC -3'

Sequencing Primer
(F):5'- ATCACTGACATGGACCCA -3'
(R):5'- TCCCGGTGAATGCCTTAAAG -3'
Posted On 2015-07-06