Incidental Mutation 'R4382:Kel'
ID325366
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 041679-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4382 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41698400 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 306 (T306S)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899]
Predicted Effect probably benign
Transcript: ENSMUST00000031899
AA Change: T306S

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: T306S

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192406
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T C 2: 91,208,109 S309P possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
B4galnt4 T C 7: 141,070,536 V772A probably damaging Het
BC067074 T C 13: 113,322,754 I1273T probably benign Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Ccdc92b G A 11: 74,630,016 S48N probably damaging Het
Ceacam12 C T 7: 18,066,034 probably benign Het
Clca3a1 T A 3: 144,760,722 M1L probably benign Het
Cnot1 T C 8: 95,769,779 T300A probably damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Col6a6 G A 9: 105,783,690 R407W probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddx60 G A 8: 61,948,978 probably null Het
Dnajb12 A T 10: 59,897,499 K372N probably benign Het
Fhl5 A C 4: 25,200,118 C239G probably benign Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Glrb T A 3: 80,879,639 R72S probably damaging Het
Gm13124 T A 4: 144,555,026 T399S possibly damaging Het
Gm6811 T C 17: 21,094,603 noncoding transcript Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hk2 A T 6: 82,735,341 L542Q probably null Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Lpo T C 11: 87,822,201 D25G probably benign Het
Mboat7 T A 7: 3,688,546 Y109F possibly damaging Het
Myh15 T G 16: 49,142,943 N1082K probably benign Het
Nagk A G 6: 83,798,011 E90G probably benign Het
Nagpa A T 16: 5,203,955 F10I possibly damaging Het
Olfr460 T A 6: 40,572,064 L226H probably damaging Het
Otog T A 7: 46,289,698 C2051S probably damaging Het
Ptpn6 A G 6: 124,727,398 V315A possibly damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rnf41 T C 10: 128,436,523 S140P probably benign Het
Ros1 C T 10: 52,120,959 V1206I possibly damaging Het
Scgb2b12 T A 7: 32,325,445 E112D probably benign Het
Serpinb3b T A 1: 107,155,543 M210L probably damaging Het
Sipa1l1 A G 12: 82,446,822 R1672G possibly damaging Het
Smc5 A G 19: 23,268,846 S70P probably benign Het
Spen C T 4: 141,473,139 G2703S possibly damaging Het
Stard9 C G 2: 120,634,222 A56G probably damaging Het
Wtap A G 17: 12,975,420 S87P probably damaging Het
Zzef1 T G 11: 72,875,112 S1488R probably benign Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 unclassified probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTCACAGGTGCCTTCCAC -3'
(R):5'- TGTGGGACTTTAGGCAGAAATG -3'

Sequencing Primer
(F):5'- ACTCACGGTGCCCCTGATAC -3'
(R):5'- GCCTTCTACCATATAGGCTAGGAG -3'
Posted On2015-07-06