Incidental Mutation 'R4382:Wtap'
ID325393
Institutional Source Beutler Lab
Gene Symbol Wtap
Ensembl Gene ENSMUSG00000060475
Gene NameWilms tumour 1-associating protein
Synonyms9430038B09Rik, 2810408K05Rik
MMRRC Submission 041679-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4382 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12966796-12992546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12975420 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 87 (S87P)
Ref Sequence ENSEMBL: ENSMUSP00000125337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007007] [ENSMUST00000159104] [ENSMUST00000159551] [ENSMUST00000159986] [ENSMUST00000160781]
Predicted Effect probably damaging
Transcript: ENSMUST00000007007
AA Change: S110P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007007
Gene: ENSMUSG00000060475
AA Change: S110P

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
coiled coil region 177 248 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159104
AA Change: S87P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125337
Gene: ENSMUSG00000060475
AA Change: S87P

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159551
AA Change: S110P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124205
Gene: ENSMUSG00000060475
AA Change: S110P

DomainStartEndE-ValueType
Pfam:Wtap 1 248 2.8e-157 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159986
AA Change: S110P

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123961
Gene: ENSMUSG00000060475
AA Change: S110P

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160781
AA Change: S110P

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124138
Gene: ENSMUSG00000060475
AA Change: S110P

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Wilms tumor suppressor gene WT1 appears to play a role in both transcriptional and posttranscriptional regulation of certain cellular genes. This gene encodes a WT1-associating protein, which is a ubiquitously expressed nuclear protein. Like WT1 protein, this protein is localized throughout the nucleoplasm as well as in speckles and partially colocalizes with splicing factors. Alternative splicing of this gene results in several transcript variants encoding three different isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a mutation display lethality during embryogenesis with abnormalities appearing during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T C 2: 91,208,109 S309P possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
B4galnt4 T C 7: 141,070,536 V772A probably damaging Het
BC067074 T C 13: 113,322,754 I1273T probably benign Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Ccdc92b G A 11: 74,630,016 S48N probably damaging Het
Ceacam12 C T 7: 18,066,034 probably benign Het
Clca3a1 T A 3: 144,760,722 M1L probably benign Het
Cnot1 T C 8: 95,769,779 T300A probably damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Col6a6 G A 9: 105,783,690 R407W probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddx60 G A 8: 61,948,978 probably null Het
Dnajb12 A T 10: 59,897,499 K372N probably benign Het
Fhl5 A C 4: 25,200,118 C239G probably benign Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Glrb T A 3: 80,879,639 R72S probably damaging Het
Gm13124 T A 4: 144,555,026 T399S possibly damaging Het
Gm6811 T C 17: 21,094,603 noncoding transcript Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hk2 A T 6: 82,735,341 L542Q probably null Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kel T A 6: 41,698,400 T306S probably benign Het
Lpo T C 11: 87,822,201 D25G probably benign Het
Mboat7 T A 7: 3,688,546 Y109F possibly damaging Het
Myh15 T G 16: 49,142,943 N1082K probably benign Het
Nagk A G 6: 83,798,011 E90G probably benign Het
Nagpa A T 16: 5,203,955 F10I possibly damaging Het
Olfr460 T A 6: 40,572,064 L226H probably damaging Het
Otog T A 7: 46,289,698 C2051S probably damaging Het
Ptpn6 A G 6: 124,727,398 V315A possibly damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rnf41 T C 10: 128,436,523 S140P probably benign Het
Ros1 C T 10: 52,120,959 V1206I possibly damaging Het
Scgb2b12 T A 7: 32,325,445 E112D probably benign Het
Serpinb3b T A 1: 107,155,543 M210L probably damaging Het
Sipa1l1 A G 12: 82,446,822 R1672G possibly damaging Het
Smc5 A G 19: 23,268,846 S70P probably benign Het
Spen C T 4: 141,473,139 G2703S possibly damaging Het
Stard9 C G 2: 120,634,222 A56G probably damaging Het
Zzef1 T G 11: 72,875,112 S1488R probably benign Het
Other mutations in Wtap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Wtap APN 17 12967895 missense probably benign 0.08
IGL01867:Wtap APN 17 12969455 missense probably benign 0.00
IGL02379:Wtap APN 17 12969449 missense probably benign
IGL02437:Wtap APN 17 12967733 missense probably benign
IGL02975:Wtap APN 17 12983511 missense possibly damaging 0.85
ANU22:Wtap UTSW 17 12967895 missense probably benign 0.08
R1457:Wtap UTSW 17 12981744 splice site probably null
R1799:Wtap UTSW 17 12980884 missense possibly damaging 0.96
R2240:Wtap UTSW 17 12975465 nonsense probably null
R2328:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R2332:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R3426:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R4703:Wtap UTSW 17 12980824 missense probably benign 0.23
R4879:Wtap UTSW 17 12969435 missense probably damaging 0.99
R4956:Wtap UTSW 17 12967536 missense probably benign 0.06
R5044:Wtap UTSW 17 12967638 missense possibly damaging 0.47
R6366:Wtap UTSW 17 12968058 splice site probably null
R6813:Wtap UTSW 17 12967510 missense probably damaging 0.96
R7324:Wtap UTSW 17 12980946 missense possibly damaging 0.91
R7443:Wtap UTSW 17 12980934 missense probably benign 0.05
R7810:Wtap UTSW 17 12980910 missense probably damaging 0.99
R7939:Wtap UTSW 17 12981796 nonsense probably null
T0970:Wtap UTSW 17 12969390 unclassified probably benign
X0067:Wtap UTSW 17 12985929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACGAGTACTTGGCTGTCCC -3'
(R):5'- CTACACCCTTAACTTTAGGGAGAC -3'

Sequencing Primer
(F):5'- ACAGCTTTCTCGAGGTGGGAC -3'
(R):5'- ACTTAATATCAAAGGGGTACAGACC -3'
Posted On2015-07-06