Incidental Mutation 'R4383:Adam23'
ID325397
Institutional Source Beutler Lab
Gene Symbol Adam23
Ensembl Gene ENSMUSG00000025964
Gene Namea disintegrin and metallopeptidase domain 23
SynonymsMDC3
MMRRC Submission 041123-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4383 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63445891-63596276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63566628 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 624 (Y624H)
Ref Sequence ENSEMBL: ENSMUSP00000109742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]
Predicted Effect probably damaging
Transcript: ENSMUST00000087374
AA Change: Y624H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964
AA Change: Y624H

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097717
SMART Domains Protein: ENSMUSP00000095324
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 2 63 6.3e-16 PFAM
Pfam:Reprolysin_5 111 286 2.7e-7 PFAM
Pfam:Reprolysin 112 309 5.7e-57 PFAM
Pfam:Reprolysin_3 136 240 8.7e-7 PFAM
DISIN 324 399 1.4e-30 SMART
ACR 400 541 3.6e-63 SMART
EGF 548 582 9e-2 SMART
transmembrane domain 607 629 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114101
SMART Domains Protein: ENSMUSP00000109736
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 87 247 1.3e-30 PFAM
Pfam:Reprolysin_5 295 470 3.3e-9 PFAM
Pfam:Reprolysin 296 493 8.1e-59 PFAM
Pfam:Reprolysin_3 320 426 1.1e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 686 4.34e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114103
AA Change: Y624H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964
AA Change: Y624H

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114107
AA Change: Y624H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964
AA Change: Y624H

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182642
SMART Domains Protein: ENSMUSP00000138362
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 2.2e-30 PFAM
Pfam:Reprolysin_5 295 470 4.6e-9 PFAM
Pfam:Reprolysin 296 493 1.4e-58 PFAM
Pfam:Reprolysin_3 320 426 1.6e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Meta Mutation Damage Score 0.9010 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 89% (32/36)
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih2 T G 9: 108,644,277 M1L probably benign Het
Asic3 A G 5: 24,413,934 T75A probably damaging Het
Baat C T 4: 49,499,731 A192T probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Clca3a2 T C 3: 144,806,320 I552V probably benign Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Des T C 1: 75,360,769 F118L possibly damaging Het
Ermard T C 17: 15,059,866 S130P possibly damaging Het
Fbxl5 A G 5: 43,762,963 probably benign Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Inmt C A 6: 55,171,218 C142F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kmt2c A T 5: 25,351,062 D1228E possibly damaging Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Msh2 G A 17: 87,689,138 E425K probably benign Het
Olfr430 T C 1: 174,069,477 Y60H probably benign Het
Poc1b A G 10: 99,156,299 D326G probably damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rsf1 A G 7: 97,685,476 K1272R possibly damaging Het
Sec24c G A 14: 20,690,773 V620M probably damaging Het
Trim3 C T 7: 105,618,399 A264T probably damaging Het
Ubr2 G C 17: 46,939,387 H1545D probably benign Het
Vps13a A T 19: 16,701,165 C1151S probably damaging Het
Zap70 C T 1: 36,780,961 R471W probably damaging Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp606 A T 7: 12,494,001 Y625F probably damaging Het
Other mutations in Adam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Adam23 APN 1 63570954 missense probably damaging 0.99
IGL00957:Adam23 APN 1 63534311 missense probably benign 0.27
IGL01338:Adam23 APN 1 63551855 missense possibly damaging 0.50
IGL01835:Adam23 APN 1 63543119 missense probably damaging 1.00
IGL01928:Adam23 APN 1 63557446 missense probably damaging 1.00
IGL02563:Adam23 APN 1 63567977 splice site probably benign
IGL02981:Adam23 APN 1 63570953 missense probably damaging 0.99
IGL03037:Adam23 APN 1 63571017 missense possibly damaging 0.63
IGL03176:Adam23 APN 1 63563416 missense probably damaging 1.00
BB007:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
BB017:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
IGL02991:Adam23 UTSW 1 63547819 critical splice donor site probably null
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0125:Adam23 UTSW 1 63534356 missense probably benign 0.00
R0477:Adam23 UTSW 1 63557400 splice site probably benign
R0538:Adam23 UTSW 1 63567844 splice site probably benign
R0617:Adam23 UTSW 1 63543147 missense probably benign 0.06
R1506:Adam23 UTSW 1 63547814 missense probably benign 0.01
R1599:Adam23 UTSW 1 63570933 missense possibly damaging 0.65
R1755:Adam23 UTSW 1 63543170 missense probably damaging 1.00
R1813:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1858:Adam23 UTSW 1 63557456 missense probably benign 0.12
R1896:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1943:Adam23 UTSW 1 63477757 critical splice donor site probably null
R2147:Adam23 UTSW 1 63534362 splice site probably null
R2211:Adam23 UTSW 1 63573129 intron probably benign
R2233:Adam23 UTSW 1 63545512 missense probably benign
R2249:Adam23 UTSW 1 63535176 nonsense probably null
R2363:Adam23 UTSW 1 63557491 splice site probably null
R3800:Adam23 UTSW 1 63551774 nonsense probably null
R3974:Adam23 UTSW 1 63547729 nonsense probably null
R3975:Adam23 UTSW 1 63547729 nonsense probably null
R4066:Adam23 UTSW 1 63563425 missense probably damaging 1.00
R4382:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4384:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4385:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R5385:Adam23 UTSW 1 63551811 missense possibly damaging 0.74
R5435:Adam23 UTSW 1 63546453 missense possibly damaging 0.73
R6465:Adam23 UTSW 1 63566668 missense probably damaging 1.00
R6490:Adam23 UTSW 1 63557454 missense probably damaging 1.00
R6967:Adam23 UTSW 1 63563336 splice site probably null
R7139:Adam23 UTSW 1 63545577 missense probably damaging 1.00
R7584:Adam23 UTSW 1 63545462 missense probably damaging 1.00
R7930:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
R8261:Adam23 UTSW 1 63528798 missense noncoding transcript
R8425:Adam23 UTSW 1 63585377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCCCATTGCAGACTGAGC -3'
(R):5'- TAGGATGCACACACTACTCATC -3'

Sequencing Primer
(F):5'- CAGAGCTTGAAATCAGCGTTTGC -3'
(R):5'- ATCCACAAGTCCCTACTTTCATTC -3'
Posted On2015-07-06