Incidental Mutation 'R4383:Des'
ID325398
Institutional Source Beutler Lab
Gene Symbol Des
Ensembl Gene ENSMUSG00000026208
Gene Namedesmin
Synonyms
MMRRC Submission 041123-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.665) question?
Stock #R4383 (G1)
Quality Score169
Status Validated
Chromosome1
Chromosomal Location75360329-75368579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75360769 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 118 (F118L)
Ref Sequence ENSEMBL: ENSMUSP00000027409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027409]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027409
AA Change: F118L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027409
Gene: ENSMUSG00000026208
AA Change: F118L

DomainStartEndE-ValueType
Pfam:Filament_head 9 105 1.3e-25 PFAM
Filament 106 414 7.41e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144894
Meta Mutation Damage Score 0.2193 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 89% (32/36)
MGI Phenotype FUNCTION: This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane and are essential for maintaining the strength and integrity of skeletal, cardiac and smooth muscle fibers. Mutations in this gene affect assembly of intermediate filaments. Mice lacking this gene are able to develop and reproduce but exhibit abnormal muscle fibers. Mutations in the human gene are associated with myofibrillar myopathy, dilated cardiomyopathy, neurogenic scapuloperoneal syndrome and autosomal recessive limb-girdle muscular dystrophy, type 2R. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit histologically detectable defects of cardiac, skeletal, and smooth muscle. Defects in the heart are most severe, and lead to calcification, progressive degeneration, and necrosis of the myocardium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arih2 T G 9: 108,644,277 M1L probably benign Het
Asic3 A G 5: 24,413,934 T75A probably damaging Het
Baat C T 4: 49,499,731 A192T probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Clca3a2 T C 3: 144,806,320 I552V probably benign Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ermard T C 17: 15,059,866 S130P possibly damaging Het
Fbxl5 A G 5: 43,762,963 probably benign Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Inmt C A 6: 55,171,218 C142F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kmt2c A T 5: 25,351,062 D1228E possibly damaging Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Msh2 G A 17: 87,689,138 E425K probably benign Het
Olfr430 T C 1: 174,069,477 Y60H probably benign Het
Poc1b A G 10: 99,156,299 D326G probably damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rsf1 A G 7: 97,685,476 K1272R possibly damaging Het
Sec24c G A 14: 20,690,773 V620M probably damaging Het
Trim3 C T 7: 105,618,399 A264T probably damaging Het
Ubr2 G C 17: 46,939,387 H1545D probably benign Het
Vps13a A T 19: 16,701,165 C1151S probably damaging Het
Zap70 C T 1: 36,780,961 R471W probably damaging Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp606 A T 7: 12,494,001 Y625F probably damaging Het
Other mutations in Des
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Des APN 1 75362583 missense probably benign 0.02
IGL02416:Des APN 1 75362728 critical splice donor site probably null
IGL02953:Des APN 1 75363644 missense possibly damaging 0.95
IGL03156:Des APN 1 75362996 missense probably damaging 1.00
IGL03288:Des APN 1 75362341 missense possibly damaging 0.79
R0032:Des UTSW 1 75362166 missense possibly damaging 0.87
R0849:Des UTSW 1 75360628 missense probably benign
R0885:Des UTSW 1 75360730 missense probably damaging 1.00
R1271:Des UTSW 1 75360646 missense probably benign 0.01
R1452:Des UTSW 1 75363477 missense probably damaging 1.00
R1559:Des UTSW 1 75360586 missense probably benign 0.11
R1929:Des UTSW 1 75363493 missense probably damaging 0.99
R2144:Des UTSW 1 75366804 missense probably benign 0.45
R2145:Des UTSW 1 75363464 splice site probably benign
R2271:Des UTSW 1 75363493 missense probably damaging 0.99
R4182:Des UTSW 1 75362584 missense probably benign 0.00
R4184:Des UTSW 1 75362584 missense probably benign 0.00
R5268:Des UTSW 1 75362928 missense possibly damaging 0.50
R5787:Des UTSW 1 75363646 missense probably damaging 0.98
R5974:Des UTSW 1 75362984 missense probably benign 0.10
R6044:Des UTSW 1 75363469 critical splice acceptor site probably null
R6985:Des UTSW 1 75366787 missense possibly damaging 0.80
R7359:Des UTSW 1 75360952 missense probably damaging 1.00
R7467:Des UTSW 1 75362961 missense possibly damaging 0.48
R7798:Des UTSW 1 75362359 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATGACATCCCGCGTGTAC -3'
(R):5'- GTCTATCAGGTTGTCACGCTC -3'

Sequencing Primer
(F):5'- ATCCCGCGTGTACCAGGTG -3'
(R):5'- CTCCACGTCGACCCGGG -3'
Posted On2015-07-06