Incidental Mutation 'R4383:Marf1'
ID 325419
Institutional Source Beutler Lab
Gene Symbol Marf1
Ensembl Gene ENSMUSG00000060657
Gene Name meiosis regulator and mRNA stability 1
Synonyms 4921513D23Rik
MMRRC Submission 041123-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R4383 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 13927030-13977157 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13960505 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 513 (Y513F)
Ref Sequence ENSEMBL: ENSMUSP00000087770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090300] [ENSMUST00000229614]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090300
AA Change: Y513F

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087770
Gene: ENSMUSG00000060657
AA Change: Y513F

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
Pfam:NYN 351 492 1.5e-21 PFAM
RRM 511 579 3.17e-1 SMART
low complexity region 599 610 N/A INTRINSIC
RRM 790 864 4.47e-3 SMART
internal_repeat_2 871 914 1.57e-5 PROSPERO
low complexity region 944 960 N/A INTRINSIC
Pfam:OST-HTH 1096 1167 1e-11 PFAM
low complexity region 1181 1186 N/A INTRINSIC
Pfam:OST-HTH 1256 1328 1.2e-10 PFAM
Pfam:OST-HTH 1332 1404 2.4e-10 PFAM
Pfam:OST-HTH 1408 1480 6.8e-13 PFAM
Pfam:OST-HTH 1483 1555 3e-14 PFAM
low complexity region 1682 1701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229614
AA Change: Y334F

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231032
Meta Mutation Damage Score 0.0659 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 89% (32/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it may be autoantigenic. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit female infertility with abnormalities in oogenic processes including meiotic progression, genomic integrity and acquisition of developmental competence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T C 1: 63,605,787 (GRCm39) Y624H probably damaging Het
Arih2 T G 9: 108,521,476 (GRCm39) M1L probably benign Het
Asic3 A G 5: 24,618,932 (GRCm39) T75A probably damaging Het
Baat C T 4: 49,499,731 (GRCm39) A192T probably damaging Het
Calr3 T A 8: 73,182,008 (GRCm39) D120V probably damaging Het
Clca3a2 T C 3: 144,512,081 (GRCm39) I552V probably benign Het
Cnot10 T A 9: 114,460,949 (GRCm39) K74* probably null Het
Des T C 1: 75,337,413 (GRCm39) F118L possibly damaging Het
Ermard T C 17: 15,280,128 (GRCm39) S130P possibly damaging Het
Fbxl5 A G 5: 43,920,305 (GRCm39) probably benign Het
Gad2 G A 2: 22,575,422 (GRCm39) V509I probably benign Het
Inmt C A 6: 55,148,203 (GRCm39) C142F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Kmt2c A T 5: 25,556,060 (GRCm39) D1228E possibly damaging Het
Msh2 G A 17: 87,996,566 (GRCm39) E425K probably benign Het
Or6n2 T C 1: 173,897,043 (GRCm39) Y60H probably benign Het
Poc1b A G 10: 98,992,161 (GRCm39) D326G probably damaging Het
Rbp3 G C 14: 33,677,253 (GRCm39) E400D probably benign Het
Rsf1 A G 7: 97,334,683 (GRCm39) K1272R possibly damaging Het
Sec24c G A 14: 20,740,841 (GRCm39) V620M probably damaging Het
Trim3 C T 7: 105,267,606 (GRCm39) A264T probably damaging Het
Ubr2 G C 17: 47,250,313 (GRCm39) H1545D probably benign Het
Vps13a A T 19: 16,678,529 (GRCm39) C1151S probably damaging Het
Zap70 C T 1: 36,820,042 (GRCm39) R471W probably damaging Het
Zfp329 G A 7: 12,545,584 (GRCm39) probably benign Het
Zfp606 A T 7: 12,227,928 (GRCm39) Y625F probably damaging Het
Other mutations in Marf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Marf1 APN 16 13,933,606 (GRCm39) missense possibly damaging 0.49
IGL00933:Marf1 APN 16 13,935,221 (GRCm39) missense probably damaging 1.00
IGL01101:Marf1 APN 16 13,964,600 (GRCm39) missense possibly damaging 0.85
IGL02140:Marf1 APN 16 13,959,776 (GRCm39) missense probably damaging 0.99
IGL03196:Marf1 APN 16 13,958,123 (GRCm39) missense possibly damaging 0.64
PIT4283001:Marf1 UTSW 16 13,946,432 (GRCm39) missense probably benign 0.22
R0016:Marf1 UTSW 16 13,970,129 (GRCm39) missense probably damaging 0.99
R0016:Marf1 UTSW 16 13,970,129 (GRCm39) missense probably damaging 0.99
R0046:Marf1 UTSW 16 13,929,591 (GRCm39) missense possibly damaging 0.83
R0046:Marf1 UTSW 16 13,929,591 (GRCm39) missense possibly damaging 0.83
R0056:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0057:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0058:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0058:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0113:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0115:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0179:Marf1 UTSW 16 13,969,040 (GRCm39) missense probably damaging 1.00
R0238:Marf1 UTSW 16 13,969,147 (GRCm39) missense probably benign 0.00
R0238:Marf1 UTSW 16 13,969,147 (GRCm39) missense probably benign 0.00
R0294:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0295:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0316:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0318:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0375:Marf1 UTSW 16 13,969,184 (GRCm39) splice site probably benign
R0383:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0391:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0504:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0589:Marf1 UTSW 16 13,959,919 (GRCm39) splice site probably benign
R0603:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0610:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R1240:Marf1 UTSW 16 13,964,626 (GRCm39) missense possibly damaging 0.48
R1445:Marf1 UTSW 16 13,933,688 (GRCm39) missense probably benign
R1716:Marf1 UTSW 16 13,960,450 (GRCm39) missense possibly damaging 0.95
R1921:Marf1 UTSW 16 13,946,465 (GRCm39) missense possibly damaging 0.63
R2098:Marf1 UTSW 16 13,932,064 (GRCm39) missense probably benign 0.00
R2155:Marf1 UTSW 16 13,950,293 (GRCm39) missense probably damaging 0.99
R2177:Marf1 UTSW 16 13,970,471 (GRCm39) missense probably benign 0.01
R2195:Marf1 UTSW 16 13,929,563 (GRCm39) missense probably benign
R2410:Marf1 UTSW 16 13,933,691 (GRCm39) missense probably benign 0.02
R2999:Marf1 UTSW 16 13,960,505 (GRCm39) missense possibly damaging 0.60
R3000:Marf1 UTSW 16 13,960,505 (GRCm39) missense possibly damaging 0.60
R3147:Marf1 UTSW 16 13,943,843 (GRCm39) missense possibly damaging 0.64
R3148:Marf1 UTSW 16 13,943,843 (GRCm39) missense possibly damaging 0.64
R3430:Marf1 UTSW 16 13,958,041 (GRCm39) unclassified probably benign
R3821:Marf1 UTSW 16 13,960,418 (GRCm39) missense probably damaging 1.00
R4384:Marf1 UTSW 16 13,960,505 (GRCm39) missense possibly damaging 0.60
R4520:Marf1 UTSW 16 13,950,530 (GRCm39) missense probably damaging 0.98
R4554:Marf1 UTSW 16 13,971,841 (GRCm39) start gained probably benign
R4557:Marf1 UTSW 16 13,971,841 (GRCm39) start gained probably benign
R4768:Marf1 UTSW 16 13,949,461 (GRCm39) missense possibly damaging 0.93
R4784:Marf1 UTSW 16 13,970,321 (GRCm39) missense probably benign
R4857:Marf1 UTSW 16 13,946,475 (GRCm39) nonsense probably null
R4863:Marf1 UTSW 16 13,950,529 (GRCm39) missense possibly damaging 0.60
R4994:Marf1 UTSW 16 13,932,095 (GRCm39) missense probably benign
R5191:Marf1 UTSW 16 13,963,942 (GRCm39) missense probably damaging 1.00
R5503:Marf1 UTSW 16 13,970,095 (GRCm39) missense probably damaging 0.99
R5813:Marf1 UTSW 16 13,970,449 (GRCm39) missense probably benign 0.35
R5905:Marf1 UTSW 16 13,945,113 (GRCm39) missense probably damaging 0.99
R5960:Marf1 UTSW 16 13,970,281 (GRCm39) missense probably damaging 0.98
R6104:Marf1 UTSW 16 13,935,319 (GRCm39) missense probably damaging 0.99
R6387:Marf1 UTSW 16 13,959,504 (GRCm39) makesense probably null
R6533:Marf1 UTSW 16 13,933,663 (GRCm39) missense probably benign 0.16
R6608:Marf1 UTSW 16 13,950,578 (GRCm39) missense probably damaging 1.00
R6642:Marf1 UTSW 16 13,950,611 (GRCm39) missense probably benign 0.02
R6954:Marf1 UTSW 16 13,956,384 (GRCm39) missense probably damaging 1.00
R6994:Marf1 UTSW 16 13,946,721 (GRCm39) missense probably damaging 1.00
R7010:Marf1 UTSW 16 13,954,865 (GRCm39) missense probably damaging 0.99
R7090:Marf1 UTSW 16 13,929,566 (GRCm39) missense possibly damaging 0.52
R7174:Marf1 UTSW 16 13,954,817 (GRCm39) missense probably damaging 1.00
R7221:Marf1 UTSW 16 13,960,349 (GRCm39) missense probably damaging 1.00
R7247:Marf1 UTSW 16 13,944,957 (GRCm39) missense probably damaging 1.00
R7557:Marf1 UTSW 16 13,950,560 (GRCm39) missense probably damaging 1.00
R7798:Marf1 UTSW 16 13,956,315 (GRCm39) missense probably benign 0.00
R7807:Marf1 UTSW 16 13,971,753 (GRCm39) nonsense probably null
R7855:Marf1 UTSW 16 13,932,065 (GRCm39) missense probably benign 0.27
R7867:Marf1 UTSW 16 13,946,470 (GRCm39) missense probably damaging 0.97
R7893:Marf1 UTSW 16 13,964,599 (GRCm39) missense probably damaging 1.00
R8291:Marf1 UTSW 16 13,950,432 (GRCm39) critical splice donor site probably null
R8746:Marf1 UTSW 16 13,935,168 (GRCm39) missense probably benign 0.18
R8842:Marf1 UTSW 16 13,935,169 (GRCm39) missense probably damaging 1.00
R9253:Marf1 UTSW 16 13,935,172 (GRCm39) missense probably damaging 1.00
R9350:Marf1 UTSW 16 13,963,789 (GRCm39) missense probably damaging 1.00
R9440:Marf1 UTSW 16 13,938,196 (GRCm39) missense probably benign 0.01
R9460:Marf1 UTSW 16 13,947,526 (GRCm39) missense probably damaging 1.00
R9658:Marf1 UTSW 16 13,958,087 (GRCm39) missense probably damaging 1.00
R9698:Marf1 UTSW 16 13,967,077 (GRCm39) missense probably benign 0.00
U24488:Marf1 UTSW 16 13,950,230 (GRCm39) nonsense probably null
X0025:Marf1 UTSW 16 13,932,142 (GRCm39) missense probably damaging 1.00
Z1176:Marf1 UTSW 16 13,933,641 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTATGTTTTGGAGTAAAGGACACG -3'
(R):5'- GCTGTGCCTAGCCGATTATTG -3'

Sequencing Primer
(F):5'- CGATGATCCTGTTGCCAAAG -3'
(R):5'- CCTAGCCGATTATTGGAAGCAGC -3'
Posted On 2015-07-06