Incidental Mutation 'R4395:Chil4'
ID 325429
Institutional Source Beutler Lab
Gene Symbol Chil4
Ensembl Gene ENSMUSG00000063779
Gene Name chitinase-like 4
Synonyms Ym2, Chi3l4
MMRRC Submission 041684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4395 (G1)
Quality Score 137
Status Not validated
Chromosome 3
Chromosomal Location 106201490-106219507 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 106203727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 284 (P284S)
Ref Sequence ENSEMBL: ENSMUSP00000080851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082219]
AlphaFold Q91Z98
Predicted Effect possibly damaging
Transcript: ENSMUST00000082219
AA Change: P284S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: P284S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.77e-132 SMART
Meta Mutation Damage Score 0.6164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,679 Y283H probably benign Het
Adamtsl5 A G 10: 80,344,902 C109R probably damaging Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Alpk3 C T 7: 81,094,955 S1266F probably damaging Het
Arfgef3 A G 10: 18,597,709 L1614P probably damaging Het
Atm T C 9: 53,465,227 R2038G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Capza2 T C 6: 17,656,450 probably null Het
Cfap43 T C 19: 47,751,913 T1274A probably benign Het
Cisd3 A G 11: 97,688,386 Y115C probably damaging Het
Crebl2 A G 6: 134,849,245 E53G probably damaging Het
Ech1 T C 7: 28,826,246 S107P probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Gm5724 T C 6: 141,712,118 I565V probably benign Het
Grm8 T A 6: 27,429,432 I488F probably damaging Het
Hmga2 C T 10: 120,476,051 G5S probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Ifit3b G T 19: 34,612,551 E376* probably null Het
Ints5 A G 19: 8,896,444 E589G probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Ltv1 T C 10: 13,190,579 Y101C probably benign Het
Maf1 T C 15: 76,352,157 probably benign Het
Map3k13 A T 16: 21,898,571 K185N possibly damaging Het
Mtus2 A T 5: 148,076,622 Q75L probably benign Het
Nod2 T A 8: 88,664,391 F427Y probably damaging Het
Olfr1496 A T 19: 13,780,911 I100F probably benign Het
Olfr470 A G 7: 107,845,262 L157P probably damaging Het
Pik3cg T C 12: 32,204,092 D632G probably damaging Het
Plekhs1 A G 19: 56,479,894 D298G probably benign Het
Rbm34 T C 8: 126,949,381 T375A probably benign Het
Slc4a7 C T 14: 14,765,665 T549I probably damaging Het
Soga3 T C 10: 29,147,355 S233P probably benign Het
Stk17b A G 1: 53,764,115 I47T probably damaging Het
Tenm2 C T 11: 36,024,624 V2028I probably benign Het
Tle4 A T 19: 14,517,938 H142Q probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpm2 T C 10: 77,929,219 I983V probably benign Het
Ttll8 C T 15: 88,915,580 A553T possibly damaging Het
Ubxn11 G T 4: 134,116,120 E171D possibly damaging Het
Other mutations in Chil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Chil4 APN 3 106201797 missense probably benign
IGL02457:Chil4 APN 3 106214399 missense probably benign
R1087:Chil4 UTSW 3 106210565 missense probably benign 0.01
R1398:Chil4 UTSW 3 106219509 splice site probably null
R1503:Chil4 UTSW 3 106206034 missense probably benign
R1553:Chil4 UTSW 3 106203690 missense probably benign 0.02
R1806:Chil4 UTSW 3 106210643 splice site probably benign
R1873:Chil4 UTSW 3 106206098 missense probably benign 0.00
R2069:Chil4 UTSW 3 106219455 missense probably benign 0.16
R2100:Chil4 UTSW 3 106214347 missense probably benign
R2370:Chil4 UTSW 3 106214300 nonsense probably null
R2984:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R2985:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R3522:Chil4 UTSW 3 106203740 missense probably benign 0.08
R3919:Chil4 UTSW 3 106202532 missense probably benign 0.00
R4033:Chil4 UTSW 3 106214449 missense probably damaging 1.00
R4181:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4184:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4301:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4347:Chil4 UTSW 3 106202828 missense probably benign
R4391:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4418:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4483:Chil4 UTSW 3 106214362 missense probably damaging 1.00
R4544:Chil4 UTSW 3 106210606 missense probably damaging 0.97
R4887:Chil4 UTSW 3 106204144 missense probably benign 0.01
R4949:Chil4 UTSW 3 106206092 missense possibly damaging 0.83
R5076:Chil4 UTSW 3 106202597 missense probably damaging 1.00
R5146:Chil4 UTSW 3 106202834 missense probably benign 0.18
R5254:Chil4 UTSW 3 106219452 missense probably benign 0.00
R5521:Chil4 UTSW 3 106203697 missense possibly damaging 0.50
R5790:Chil4 UTSW 3 106202578 missense probably benign 0.00
R5883:Chil4 UTSW 3 106210570 missense possibly damaging 0.48
R6010:Chil4 UTSW 3 106214395 missense probably damaging 1.00
R6257:Chil4 UTSW 3 106204096 missense possibly damaging 0.84
R6269:Chil4 UTSW 3 106204171 missense probably damaging 1.00
R6602:Chil4 UTSW 3 106210590 missense probably benign 0.00
R7113:Chil4 UTSW 3 106202767 missense probably damaging 1.00
R7113:Chil4 UTSW 3 106214348 missense probably benign
R7188:Chil4 UTSW 3 106204159 missense probably damaging 1.00
R7980:Chil4 UTSW 3 106202744 missense probably damaging 1.00
R8810:Chil4 UTSW 3 106201805 missense probably damaging 0.99
R9300:Chil4 UTSW 3 106202558 missense probably benign 0.10
R9307:Chil4 UTSW 3 106204066 critical splice donor site probably null
R9529:Chil4 UTSW 3 106211340 missense probably damaging 1.00
X0067:Chil4 UTSW 3 106206034 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTGCTTAGGAAGAGTACATACTG -3'
(R):5'- GATTAATGCATGAGCCTATGCC -3'

Sequencing Primer
(F):5'- GTCTGTAAATCACTAAGCACAC -3'
(R):5'- GCATGAGCCTATGCCATTTATTG -3'
Posted On 2015-07-06