Mutagenetix > Incidental Mutation

Incidental Mutation 'R4395:Grm8'

325435

Institutional Source

Beutler Lab

Gene Symbol

Grm8

Ensembl Gene

ENSMUSG00000024211

Gene Name

glutamate receptor, metabotropic 8

Synonyms

mGluR8, Gprc1h

MMRRC Submission

041684-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4395 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27275119-28135178 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27429432 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 488 (I488F)

Ref Sequence

ENSEMBL: ENSMUSP00000110979 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324]

AlphaFold

P47743

Predicted Effect

probably damaging
Transcript: ENSMUST00000090512
AA Change: I488F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: I488F

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	9.6e-102	PFAM
Pfam:Peripla_BP_6	141	375	1.3e-9	PFAM
Pfam:NCD3G	512	562	5e-17	PFAM
Pfam:7tm_3	593	841	4.7e-88	PFAM
low complexity region	887	905	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115323
AA Change: I488F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: I488F

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	3.3e-107	PFAM
Pfam:NCD3G	512	562	9e-14	PFAM
Pfam:7tm_3	595	840	6.8e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115324
AA Change: I488F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: I488F

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	2.1e-101	PFAM
Pfam:Peripla_BP_6	141	375	9.2e-10	PFAM
Pfam:NCD3G	512	562	2.8e-16	PFAM
Pfam:7tm_3	593	841	2.4e-87	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat1	A	G	4: 49,447,679	Y283H	probably benign	Het
Adamtsl5	A	G	10: 80,344,902	C109R	probably damaging	Het
Adgrg4	T	G	X: 56,932,343	L2193V	probably damaging	Het
Alpk3	C	T	7: 81,094,955	S1266F	probably damaging	Het
Arfgef3	A	G	10: 18,597,709	L1614P	probably damaging	Het
Atm	T	C	9: 53,465,227	R2038G	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Capza2	T	C	6: 17,656,450		probably null	Het
Cfap43	T	C	19: 47,751,913	T1274A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Cisd3	A	G	11: 97,688,386	Y115C	probably damaging	Het
Crebl2	A	G	6: 134,849,245	E53G	probably damaging	Het
Ech1	T	C	7: 28,826,246	S107P	probably damaging	Het
Fam3b	C	A	16: 97,481,786		probably null	Het
Fat1	T	A	8: 44,952,346	N711K	probably damaging	Het
Gm5724	T	C	6: 141,712,118	I565V	probably benign	Het
Hmga2	C	T	10: 120,476,051	G5S	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Ifit3b	G	T	19: 34,612,551	E376*	probably null	Het
Ints5	A	G	19: 8,896,444	E589G	probably damaging	Het
Iqsec2	C	T	X: 152,209,053	T562I	probably damaging	Het
Lamc3	A	G	2: 31,931,952	E1304G	probably benign	Het
Ltv1	T	C	10: 13,190,579	Y101C	probably benign	Het
Maf1	T	C	15: 76,352,157		probably benign	Het
Map3k13	A	T	16: 21,898,571	K185N	possibly damaging	Het
Mtus2	A	T	5: 148,076,622	Q75L	probably benign	Het
Nod2	T	A	8: 88,664,391	F427Y	probably damaging	Het
Olfr1496	A	T	19: 13,780,911	I100F	probably benign	Het
Olfr470	A	G	7: 107,845,262	L157P	probably damaging	Het
Pik3cg	T	C	12: 32,204,092	D632G	probably damaging	Het
Plekhs1	A	G	19: 56,479,894	D298G	probably benign	Het
Rbm34	T	C	8: 126,949,381	T375A	probably benign	Het
Slc4a7	C	T	14: 14,765,665	T549I	probably damaging	Het
Soga3	T	C	10: 29,147,355	S233P	probably benign	Het
Stk17b	A	G	1: 53,764,115	I47T	probably damaging	Het
Tenm2	C	T	11: 36,024,624	V2028I	probably benign	Het
Tle4	A	T	19: 14,517,938	H142Q	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Trpm2	T	C	10: 77,929,219	I983V	probably benign	Het
Ttll8	C	T	15: 88,915,580	A553T	possibly damaging	Het
Ubxn11	G	T	4: 134,116,120	E171D	possibly damaging	Het

Other mutations in Grm8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Grm8	APN	6	27363801	missense	probably damaging	1.00
IGL01412:Grm8	APN	6	27762461	missense	probably damaging	1.00
IGL02329:Grm8	APN	6	27363116	missense	probably damaging	1.00
IGL02342:Grm8	APN	6	27363804	missense	probably benign	0.00
IGL02584:Grm8	APN	6	27762439	missense	probably benign	0.35
IGL03040:Grm8	APN	6	28126123	start codon destroyed	probably null	0.01
IGL03112:Grm8	APN	6	27363263	missense	probably damaging	1.00
IGL03139:Grm8	APN	6	27618650	missense	probably damaging	1.00
IGL03287:Grm8	APN	6	27760255	missense	possibly damaging	0.86
R0137:Grm8	UTSW	6	27762390	missense	probably damaging	0.99
R0266:Grm8	UTSW	6	27285896	missense	probably damaging	1.00
R0347:Grm8	UTSW	6	27981222	missense	probably benign	0.37
R0580:Grm8	UTSW	6	27761371	splice site	probably benign
R0698:Grm8	UTSW	6	27363914	missense	probably damaging	1.00
R0833:Grm8	UTSW	6	27363179	missense	probably damaging	1.00
R1301:Grm8	UTSW	6	27981201	missense	possibly damaging	0.94
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1471:Grm8	UTSW	6	27363309	missense	possibly damaging	0.79
R1554:Grm8	UTSW	6	28125853	missense	probably benign	0.01
R1638:Grm8	UTSW	6	28125883	nonsense	probably null
R1763:Grm8	UTSW	6	27285867	missense	possibly damaging	0.79
R1899:Grm8	UTSW	6	28125895	missense	probably damaging	1.00
R1902:Grm8	UTSW	6	27429482	missense	probably damaging	1.00
R1916:Grm8	UTSW	6	27363584	missense	probably benign	0.01
R2257:Grm8	UTSW	6	27760225	missense	probably damaging	0.98
R2351:Grm8	UTSW	6	28126119	missense	possibly damaging	0.66
R2396:Grm8	UTSW	6	27761242	missense	probably damaging	0.98
R3801:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3802:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3803:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3804:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3830:Grm8	UTSW	6	27761229	nonsense	probably null
R3844:Grm8	UTSW	6	27429508	missense	possibly damaging	0.69
R4006:Grm8	UTSW	6	27981230	missense	probably damaging	1.00
R4077:Grm8	UTSW	6	27760209	missense	probably benign	0.01
R4436:Grm8	UTSW	6	27761238	missense	possibly damaging	0.48
R4810:Grm8	UTSW	6	27761296	missense	possibly damaging	0.87
R5357:Grm8	UTSW	6	27762419	missense	probably damaging	1.00
R5677:Grm8	UTSW	6	27761204	critical splice donor site	probably null
R5983:Grm8	UTSW	6	27760221	missense	probably benign	0.03
R5990:Grm8	UTSW	6	27363624	missense	probably damaging	1.00
R6365:Grm8	UTSW	6	27363227	missense	probably damaging	1.00
R6454:Grm8	UTSW	6	27363776	missense	possibly damaging	0.68
R6713:Grm8	UTSW	6	27363191	missense	probably damaging	1.00
R6960:Grm8	UTSW	6	27981282	missense	probably damaging	0.98
R7194:Grm8	UTSW	6	27618487	missense	probably benign	0.01
R7259:Grm8	UTSW	6	27760176	missense	probably null	0.99
R7305:Grm8	UTSW	6	27761355	missense	possibly damaging	0.51
R7421:Grm8	UTSW	6	27762477	missense	possibly damaging	0.66
R7561:Grm8	UTSW	6	27429525	missense	probably benign	0.44
R7605:Grm8	UTSW	6	27618679	missense	probably damaging	1.00
R7651:Grm8	UTSW	6	27760258	missense	possibly damaging	0.46
R7775:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7778:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7781:Grm8	UTSW	6	27285787	missense	probably benign
R7785:Grm8	UTSW	6	27618637	missense	probably damaging	0.99
R7898:Grm8	UTSW	6	27762423	missense	probably damaging	1.00
R8272:Grm8	UTSW	6	27363282	missense	probably damaging	1.00
R8274:Grm8	UTSW	6	27761336	missense	probably benign	0.31
R8501:Grm8	UTSW	6	27618541	missense	probably damaging	0.98
R8695:Grm8	UTSW	6	28126031	missense	probably benign	0.01
R8824:Grm8	UTSW	6	27761352	missense	probably damaging	1.00
R8869:Grm8	UTSW	6	27363753	missense	probably benign	0.26
R9322:Grm8	UTSW	6	27363729	missense	possibly damaging	0.88
R9337:Grm8	UTSW	6	27761215	missense	probably benign	0.01
R9518:Grm8	UTSW	6	27429470	missense	probably benign	0.01
RF013:Grm8	UTSW	6	27363780	missense	probably damaging	1.00
Z1176:Grm8	UTSW	6	28126027	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- ATACATGCCAGCTGCCATAG -3'
(R):5'- CCTTAGAGGAAAATAAGCCCAATG -3'

Sequencing Primer
(F):5'- AGCCTGGTCTCTAAGTGTATAATCC -3'
(R):5'- CCCAATGGGCTATGGTACTATAG -3'

Posted On

2015-07-06