Incidental Mutation 'R4395:Crebl2'
ID325436
Institutional Source Beutler Lab
Gene Symbol Crebl2
Ensembl Gene ENSMUSG00000032652
Gene NamecAMP responsive element binding protein-like 2
Synonyms
MMRRC Submission 041684-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4395 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location134830154-134858931 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134849245 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 53 (E53G)
Ref Sequence ENSEMBL: ENSMUSP00000035304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046303] [ENSMUST00000111937]
Predicted Effect probably damaging
Transcript: ENSMUST00000046303
AA Change: E53G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035304
Gene: ENSMUSG00000032652
AA Change: E53G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:bZIP_2 24 75 3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111937
AA Change: E53G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107568
Gene: ENSMUSG00000032652
AA Change: E53G

DomainStartEndE-ValueType
Pfam:bZIP_1 21 73 4.3e-8 PFAM
Pfam:bZIP_2 24 72 5.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203742
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP response element (CRE)-binding protein-like-2 (CREBL2) was identified in a search to find genes in a commonly deleted region on chromosome 12p13 flanked by ETV6 and CDKN1B genes, frequently associated with hematopoietic malignancies, as well as breast, non-small-cell lung and ovarian cancers. CREBL2 shares a 41% identity with CRE-binding protein (CREB) over a 48-base long region which encodes the bZip domain of CREB. The bZip domain consists of about 30 amino acids rich in basic residues involved in DNA binding, followed by a leucine zipper motif involved in protein dimerization. This suggests that CREBL2 encodes a protein with DNA binding capabilities. The occurance of CREBL2 deletion in malignancy suggests that CREBL2 may act as a tumor suppressor gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,679 Y283H probably benign Het
Adamtsl5 A G 10: 80,344,902 C109R probably damaging Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Alpk3 C T 7: 81,094,955 S1266F probably damaging Het
Arfgef3 A G 10: 18,597,709 L1614P probably damaging Het
Atm T C 9: 53,465,227 R2038G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Capza2 T C 6: 17,656,450 probably null Het
Cfap43 T C 19: 47,751,913 T1274A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cisd3 A G 11: 97,688,386 Y115C probably damaging Het
Ech1 T C 7: 28,826,246 S107P probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Gm5724 T C 6: 141,712,118 I565V probably benign Het
Grm8 T A 6: 27,429,432 I488F probably damaging Het
Hmga2 C T 10: 120,476,051 G5S probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Ifit3b G T 19: 34,612,551 E376* probably null Het
Ints5 A G 19: 8,896,444 E589G probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Ltv1 T C 10: 13,190,579 Y101C probably benign Het
Maf1 T C 15: 76,352,157 probably benign Het
Map3k13 A T 16: 21,898,571 K185N possibly damaging Het
Mtus2 A T 5: 148,076,622 Q75L probably benign Het
Nod2 T A 8: 88,664,391 F427Y probably damaging Het
Olfr1496 A T 19: 13,780,911 I100F probably benign Het
Olfr470 A G 7: 107,845,262 L157P probably damaging Het
Pik3cg T C 12: 32,204,092 D632G probably damaging Het
Plekhs1 A G 19: 56,479,894 D298G probably benign Het
Rbm34 T C 8: 126,949,381 T375A probably benign Het
Slc4a7 C T 14: 14,765,665 T549I probably damaging Het
Soga3 T C 10: 29,147,355 S233P probably benign Het
Stk17b A G 1: 53,764,115 I47T probably damaging Het
Tenm2 C T 11: 36,024,624 V2028I probably benign Het
Tle4 A T 19: 14,517,938 H142Q probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpm2 T C 10: 77,929,219 I983V probably benign Het
Ttll8 C T 15: 88,915,580 A553T possibly damaging Het
Ubxn11 G T 4: 134,116,120 E171D possibly damaging Het
Other mutations in Crebl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Crebl2 APN 6 134849195 missense probably damaging 1.00
R1886:Crebl2 UTSW 6 134851096 missense probably benign
R2100:Crebl2 UTSW 6 134851203 missense probably benign
R5517:Crebl2 UTSW 6 134851176 missense probably benign 0.00
R5747:Crebl2 UTSW 6 134851140 missense probably damaging 1.00
Z1176:Crebl2 UTSW 6 134849289 nonsense probably null
Z1177:Crebl2 UTSW 6 134830433 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGTAGGCAGCCATAGTTG -3'
(R):5'- TGAAAAGAGCTCCACATTGTCTCC -3'

Sequencing Primer
(F):5'- CAGTAGGCAGCCATAGTTGTTTTTCC -3'
(R):5'- TCCAATGTGAGCACTGATGGC -3'
Posted On2015-07-06