Incidental Mutation 'R4395:Ech1'
ID325438
Institutional Source Beutler Lab
Gene Symbol Ech1
Ensembl Gene ENSMUSG00000053898
Gene Nameenoyl coenzyme A hydratase 1, peroxisomal
Synonymsdienoyl-CoA isomerase
MMRRC Submission 041684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4395 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28825217-28832247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28826246 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 107 (S107P)
Ref Sequence ENSEMBL: ENSMUSP00000066092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038572] [ENSMUST00000066264] [ENSMUST00000132376] [ENSMUST00000172529] [ENSMUST00000174548] [ENSMUST00000174882]
Predicted Effect probably benign
Transcript: ENSMUST00000038572
SMART Domains Protein: ENSMUSP00000049407
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066264
AA Change: S107P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066092
Gene: ENSMUSG00000053898
AA Change: S107P

DomainStartEndE-ValueType
Pfam:ECH_1 61 321 7.2e-50 PFAM
Pfam:ECH_2 66 258 9.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127590
Predicted Effect probably benign
Transcript: ENSMUST00000132376
AA Change: S15P

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116992
Gene: ENSMUSG00000053898
AA Change: S15P

DomainStartEndE-ValueType
Pfam:ECH 26 166 2.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154839
Predicted Effect probably benign
Transcript: ENSMUST00000172529
SMART Domains Protein: ENSMUSP00000133932
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
Blast:RRM 1 39 9e-20 BLAST
RRM 61 131 4.75e-7 SMART
low complexity region 184 209 N/A INTRINSIC
low complexity region 226 244 N/A INTRINSIC
RRM 250 319 5.09e-7 SMART
Blast:RRM_2 369 442 6e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174477
SMART Domains Protein: ENSMUSP00000134734
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
low complexity region 4 49 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
RRM 92 161 9.8e-9 SMART
RRM 183 253 4.75e-7 SMART
low complexity region 339 368 N/A INTRINSIC
low complexity region 385 403 N/A INTRINSIC
RRM 409 478 5.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174526
Predicted Effect probably benign
Transcript: ENSMUST00000174548
SMART Domains Protein: ENSMUSP00000133728
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174882
SMART Domains Protein: ENSMUSP00000133952
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
RRM 1 61 5.18e-1 SMART
RRM 83 153 4.75e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydratase/isomerase superfamily. The gene product shows high sequence similarity to enoyl-coenzyme A (CoA) hydratases of several species, particularly within a conserved domain characteristic of these proteins. The encoded protein, which contains a C-terminal peroxisomal targeting sequence, localizes to the peroxisome. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans,5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. This enzyme functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,679 Y283H probably benign Het
Adamtsl5 A G 10: 80,344,902 C109R probably damaging Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Alpk3 C T 7: 81,094,955 S1266F probably damaging Het
Arfgef3 A G 10: 18,597,709 L1614P probably damaging Het
Atm T C 9: 53,465,227 R2038G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Capza2 T C 6: 17,656,450 probably null Het
Cfap43 T C 19: 47,751,913 T1274A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cisd3 A G 11: 97,688,386 Y115C probably damaging Het
Crebl2 A G 6: 134,849,245 E53G probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Gm5724 T C 6: 141,712,118 I565V probably benign Het
Grm8 T A 6: 27,429,432 I488F probably damaging Het
Hmga2 C T 10: 120,476,051 G5S probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Ifit3b G T 19: 34,612,551 E376* probably null Het
Ints5 A G 19: 8,896,444 E589G probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Ltv1 T C 10: 13,190,579 Y101C probably benign Het
Maf1 T C 15: 76,352,157 probably benign Het
Map3k13 A T 16: 21,898,571 K185N possibly damaging Het
Mtus2 A T 5: 148,076,622 Q75L probably benign Het
Nod2 T A 8: 88,664,391 F427Y probably damaging Het
Olfr1496 A T 19: 13,780,911 I100F probably benign Het
Olfr470 A G 7: 107,845,262 L157P probably damaging Het
Pik3cg T C 12: 32,204,092 D632G probably damaging Het
Plekhs1 A G 19: 56,479,894 D298G probably benign Het
Rbm34 T C 8: 126,949,381 T375A probably benign Het
Slc4a7 C T 14: 14,765,665 T549I probably damaging Het
Soga3 T C 10: 29,147,355 S233P probably benign Het
Stk17b A G 1: 53,764,115 I47T probably damaging Het
Tenm2 C T 11: 36,024,624 V2028I probably benign Het
Tle4 A T 19: 14,517,938 H142Q probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpm2 T C 10: 77,929,219 I983V probably benign Het
Ttll8 C T 15: 88,915,580 A553T possibly damaging Het
Ubxn11 G T 4: 134,116,120 E171D possibly damaging Het
Other mutations in Ech1
AlleleSourceChrCoordTypePredicted EffectPPH Score
pudgy UTSW 7 28830338 intron probably null
R1640:Ech1 UTSW 7 28831839 missense probably damaging 1.00
R1797:Ech1 UTSW 7 28831863 missense probably damaging 1.00
R3612:Ech1 UTSW 7 28830243 missense probably damaging 1.00
R4698:Ech1 UTSW 7 28832053 missense probably benign 0.03
R6217:Ech1 UTSW 7 28831836 missense possibly damaging 0.91
R6396:Ech1 UTSW 7 28830338 intron probably null
R6427:Ech1 UTSW 7 28825885 missense probably benign 0.00
R6514:Ech1 UTSW 7 28826015 missense possibly damaging 0.91
R6681:Ech1 UTSW 7 28830338 intron probably null
R6999:Ech1 UTSW 7 28830264 missense probably benign 0.28
R7448:Ech1 UTSW 7 28826198 missense probably damaging 1.00
R7544:Ech1 UTSW 7 28825967 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACAGGGCTTTCTGGAGGTC -3'
(R):5'- TCCTTCTAGAAACAAAAGGAGGCC -3'

Sequencing Primer
(F):5'- GCTTTCTGGAGGTCTGGCC -3'
(R):5'- AAACTGCTAGCATGGCTG -3'
Posted On2015-07-06