Mutagenetix > Incidental Mutation

Incidental Mutation 'R4395:Homer3'

325442

Institutional Source

Beutler Lab

Gene Symbol

Homer3

Ensembl Gene

ENSMUSG00000003573

Gene Name

homer scaffolding protein 3

Synonyms

MMRRC Submission

041684-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.229) question?

Stock #

R4395 (G1)

Quality Score

184

Status

Not validated

Chromosome

Chromosomal Location

70282827-70294361 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 70290143 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000087467] [ENSMUST00000110124] [ENSMUST00000140212]

AlphaFold

Q99JP6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003669
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573
AA Change: R168Q

Domain	Start	End	E-Value	Type
WH1	4	110	4.92e-37	SMART
low complexity region	198	210	N/A	INTRINSIC
PDB:3CVF\|D	285	342	2e-10	PDB
low complexity region	343	358	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000008004

SMART Domains

Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

Domain	Start	End	E-Value	Type
DEXDc	21	222	1.85e-57	SMART
HELICc	262	343	2.41e-29	SMART
low complexity region	369	383	N/A	INTRINSIC
low complexity region	461	470	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087467

SMART Domains

Protein: ENSMUSP00000084735
Gene: ENSMUSG00000003573

Domain	Start	End	E-Value	Type
Pfam:WH1	1	107	4.2e-36	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110124
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573
AA Change: R168Q

Domain	Start	End	E-Value	Type
WH1	4	110	4.92e-37	SMART
low complexity region	198	210	N/A	INTRINSIC
PDB:3CVF\|D	285	342	2e-10	PDB
low complexity region	343	358	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127094

Predicted Effect

probably null
Transcript: ENSMUST00000135368

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135692

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140212
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573
AA Change: R168Q

Domain	Start	End	E-Value	Type
WH1	4	110	4.92e-37	SMART
low complexity region	198	210	N/A	INTRINSIC
PDB:3CVF\|D	282	339	2e-10	PDB
low complexity region	340	355	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155711

Meta Mutation Damage Score

0.3504

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants exhibit normal sensitivity to cocaine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat1	A	G	4: 49,447,679	Y283H	probably benign	Het
Adamtsl5	A	G	10: 80,344,902	C109R	probably damaging	Het
Adgrg4	T	G	X: 56,932,343	L2193V	probably damaging	Het
Alpk3	C	T	7: 81,094,955	S1266F	probably damaging	Het
Arfgef3	A	G	10: 18,597,709	L1614P	probably damaging	Het
Atm	T	C	9: 53,465,227	R2038G	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Capza2	T	C	6: 17,656,450		probably null	Het
Cfap43	T	C	19: 47,751,913	T1274A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Cisd3	A	G	11: 97,688,386	Y115C	probably damaging	Het
Crebl2	A	G	6: 134,849,245	E53G	probably damaging	Het
Ech1	T	C	7: 28,826,246	S107P	probably damaging	Het
Fam3b	C	A	16: 97,481,786		probably null	Het
Fat1	T	A	8: 44,952,346	N711K	probably damaging	Het
Gm5724	T	C	6: 141,712,118	I565V	probably benign	Het
Grm8	T	A	6: 27,429,432	I488F	probably damaging	Het
Hmga2	C	T	10: 120,476,051	G5S	probably damaging	Het
Ifit3b	G	T	19: 34,612,551	E376*	probably null	Het
Ints5	A	G	19: 8,896,444	E589G	probably damaging	Het
Iqsec2	C	T	X: 152,209,053	T562I	probably damaging	Het
Lamc3	A	G	2: 31,931,952	E1304G	probably benign	Het
Ltv1	T	C	10: 13,190,579	Y101C	probably benign	Het
Maf1	T	C	15: 76,352,157		probably benign	Het
Map3k13	A	T	16: 21,898,571	K185N	possibly damaging	Het
Mtus2	A	T	5: 148,076,622	Q75L	probably benign	Het
Nod2	T	A	8: 88,664,391	F427Y	probably damaging	Het
Olfr1496	A	T	19: 13,780,911	I100F	probably benign	Het
Olfr470	A	G	7: 107,845,262	L157P	probably damaging	Het
Pik3cg	T	C	12: 32,204,092	D632G	probably damaging	Het
Plekhs1	A	G	19: 56,479,894	D298G	probably benign	Het
Rbm34	T	C	8: 126,949,381	T375A	probably benign	Het
Slc4a7	C	T	14: 14,765,665	T549I	probably damaging	Het
Soga3	T	C	10: 29,147,355	S233P	probably benign	Het
Stk17b	A	G	1: 53,764,115	I47T	probably damaging	Het
Tenm2	C	T	11: 36,024,624	V2028I	probably benign	Het
Tle4	A	T	19: 14,517,938	H142Q	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Trpm2	T	C	10: 77,929,219	I983V	probably benign	Het
Ttll8	C	T	15: 88,915,580	A553T	possibly damaging	Het
Ubxn11	G	T	4: 134,116,120	E171D	possibly damaging	Het

Other mutations in Homer3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01966:Homer3	APN	8	70290157	missense	probably damaging	0.96
IGL02493:Homer3	APN	8	70290071	missense	probably benign	0.00
IGL03134:Homer3	UTSW	8	70286335	missense	probably benign	0.00
R2436:Homer3	UTSW	8	70293056	missense	possibly damaging	0.91
R3508:Homer3	UTSW	8	70291355	missense	probably benign	0.06
R4391:Homer3	UTSW	8	70290143	splice site	probably null
R4392:Homer3	UTSW	8	70290143	splice site	probably null
R4396:Homer3	UTSW	8	70290143	splice site	probably null
R4397:Homer3	UTSW	8	70290143	splice site	probably null
R4401:Homer3	UTSW	8	70290143	splice site	probably null
R4402:Homer3	UTSW	8	70290143	splice site	probably null
R4445:Homer3	UTSW	8	70290143	splice site	probably null
R4446:Homer3	UTSW	8	70290143	splice site	probably null
R4482:Homer3	UTSW	8	70290143	splice site	probably null
R4488:Homer3	UTSW	8	70290143	splice site	probably null
R4489:Homer3	UTSW	8	70290143	splice site	probably null
R4664:Homer3	UTSW	8	70290143	splice site	probably null
R4666:Homer3	UTSW	8	70290143	splice site	probably null
R4751:Homer3	UTSW	8	70285434	missense	probably damaging	1.00
R5071:Homer3	UTSW	8	70291355	missense	probably benign
R5828:Homer3	UTSW	8	70286306	missense	probably benign	0.02
R6052:Homer3	UTSW	8	70291426	nonsense	probably null
R6211:Homer3	UTSW	8	70285524	missense	probably damaging	1.00
R6234:Homer3	UTSW	8	70291165	critical splice donor site	probably null
R6895:Homer3	UTSW	8	70285305	missense	probably damaging	0.99
R6914:Homer3	UTSW	8	70291551	missense	probably benign	0.00
R6942:Homer3	UTSW	8	70291551	missense	probably benign	0.00
R7300:Homer3	UTSW	8	70285303	start codon destroyed	probably null	0.23
R7391:Homer3	UTSW	8	70289484	missense	probably benign	0.00
R7553:Homer3	UTSW	8	70290124	missense	probably benign	0.02
R7555:Homer3	UTSW	8	70289413	missense	probably damaging	1.00
R7721:Homer3	UTSW	8	70291012	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TACCCCAGTGGCTTCAATCAAC -3'
(R):5'- CCTTTAGTGACAATCAAGACCCTG -3'

Sequencing Primer
(F):5'- CCAGTGGCTTCAATCAACTTTAC -3'
(R):5'- AATTTCTGAGTTCGAGGCCAGC -3'

Posted On

2015-07-06