Incidental Mutation 'R4395:Rbm34'
ID325444
Institutional Source Beutler Lab
Gene Symbol Rbm34
Ensembl Gene ENSMUSG00000033931
Gene NameRNA binding motif protein 34
Synonyms4930547K05Rik, D8Ertd233e
MMRRC Submission 041684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4395 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location126947172-126971071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126949381 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 375 (T375A)
Ref Sequence ENSEMBL: ENSMUSP00000148473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045994] [ENSMUST00000179857] [ENSMUST00000212618] [ENSMUST00000212771]
Predicted Effect probably benign
Transcript: ENSMUST00000045994
AA Change: T395A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000048450
Gene: ENSMUSG00000033931
AA Change: T395A

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 41 53 N/A INTRINSIC
low complexity region 83 91 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 140 152 N/A INTRINSIC
RRM 190 280 5.33e-10 SMART
RRM 292 364 5.2e-22 SMART
internal_repeat_2 394 404 6.88e-5 PROSPERO
internal_repeat_2 401 411 6.88e-5 PROSPERO
low complexity region 423 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083703
Predicted Effect probably benign
Transcript: ENSMUST00000179857
SMART Domains Protein: ENSMUSP00000136493
Gene: ENSMUSG00000093904

DomainStartEndE-ValueType
Pfam:MAS20 10 124 3.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212618
AA Change: T375A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000212771
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA-binding motif family of RNA recognition motif proteins. The encoded protein contains an RNA-binding domain made up of two RNA recognition motif subdomains referred to as RNA recognition motif-1 and RNA recognition motif-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,679 Y283H probably benign Het
Adamtsl5 A G 10: 80,344,902 C109R probably damaging Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Alpk3 C T 7: 81,094,955 S1266F probably damaging Het
Arfgef3 A G 10: 18,597,709 L1614P probably damaging Het
Atm T C 9: 53,465,227 R2038G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Capza2 T C 6: 17,656,450 probably null Het
Cfap43 T C 19: 47,751,913 T1274A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cisd3 A G 11: 97,688,386 Y115C probably damaging Het
Crebl2 A G 6: 134,849,245 E53G probably damaging Het
Ech1 T C 7: 28,826,246 S107P probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Gm5724 T C 6: 141,712,118 I565V probably benign Het
Grm8 T A 6: 27,429,432 I488F probably damaging Het
Hmga2 C T 10: 120,476,051 G5S probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Ifit3b G T 19: 34,612,551 E376* probably null Het
Ints5 A G 19: 8,896,444 E589G probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Ltv1 T C 10: 13,190,579 Y101C probably benign Het
Maf1 T C 15: 76,352,157 probably benign Het
Map3k13 A T 16: 21,898,571 K185N possibly damaging Het
Mtus2 A T 5: 148,076,622 Q75L probably benign Het
Nod2 T A 8: 88,664,391 F427Y probably damaging Het
Olfr1496 A T 19: 13,780,911 I100F probably benign Het
Olfr470 A G 7: 107,845,262 L157P probably damaging Het
Pik3cg T C 12: 32,204,092 D632G probably damaging Het
Plekhs1 A G 19: 56,479,894 D298G probably benign Het
Slc4a7 C T 14: 14,765,665 T549I probably damaging Het
Soga3 T C 10: 29,147,355 S233P probably benign Het
Stk17b A G 1: 53,764,115 I47T probably damaging Het
Tenm2 C T 11: 36,024,624 V2028I probably benign Het
Tle4 A T 19: 14,517,938 H142Q probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpm2 T C 10: 77,929,219 I983V probably benign Het
Ttll8 C T 15: 88,915,580 A553T possibly damaging Het
Ubxn11 G T 4: 134,116,120 E171D possibly damaging Het
Other mutations in Rbm34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Rbm34 APN 8 126969986 missense probably benign 0.10
IGL02505:Rbm34 APN 8 126949321 missense probably benign 0.08
IGL03166:Rbm34 APN 8 126970856 missense probably damaging 1.00
R0081:Rbm34 UTSW 8 126949484 missense probably damaging 0.99
R1186:Rbm34 UTSW 8 126965447 nonsense probably null
R1257:Rbm34 UTSW 8 126970893 missense possibly damaging 0.45
R1867:Rbm34 UTSW 8 126970881 missense probably benign 0.17
R1868:Rbm34 UTSW 8 126970881 missense probably benign 0.17
R4008:Rbm34 UTSW 8 126949287 missense probably benign 0.00
R4823:Rbm34 UTSW 8 126970905 missense probably benign 0.01
R4903:Rbm34 UTSW 8 126951337 missense possibly damaging 0.71
R4964:Rbm34 UTSW 8 126951337 missense possibly damaging 0.71
R4966:Rbm34 UTSW 8 126951337 missense possibly damaging 0.71
R5605:Rbm34 UTSW 8 126949419 missense probably benign 0.05
R5734:Rbm34 UTSW 8 126970130 critical splice acceptor site probably null
R6515:Rbm34 UTSW 8 126961932 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ACTCATTGCAAGGTTTCACCAC -3'
(R):5'- CATTGCATATCACTTTCTGGTGG -3'

Sequencing Primer
(F):5'- TTGCAAGGTTTCACCACAGAAAG -3'
(R):5'- ATGTTTCTCCTTATTGCAGAACACAG -3'
Posted On2015-07-06