Incidental Mutation 'R4395:Arfgef3'
ID325447
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene NameARFGEF family member 3
SynonymsB930094H20Rik, D10Bwg1379e, BIG3
MMRRC Submission 041684-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4395 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location18581839-18743949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18597709 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1614 (L1614P)
Ref Sequence ENSEMBL: ENSMUSP00000019999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
Predicted Effect probably damaging
Transcript: ENSMUST00000019999
AA Change: L1614P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: L1614P

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215836
AA Change: L1614P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,679 Y283H probably benign Het
Adamtsl5 A G 10: 80,344,902 C109R probably damaging Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Alpk3 C T 7: 81,094,955 S1266F probably damaging Het
Atm T C 9: 53,465,227 R2038G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Capza2 T C 6: 17,656,450 probably null Het
Cfap43 T C 19: 47,751,913 T1274A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cisd3 A G 11: 97,688,386 Y115C probably damaging Het
Crebl2 A G 6: 134,849,245 E53G probably damaging Het
Ech1 T C 7: 28,826,246 S107P probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Gm5724 T C 6: 141,712,118 I565V probably benign Het
Grm8 T A 6: 27,429,432 I488F probably damaging Het
Hmga2 C T 10: 120,476,051 G5S probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Ifit3b G T 19: 34,612,551 E376* probably null Het
Ints5 A G 19: 8,896,444 E589G probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Ltv1 T C 10: 13,190,579 Y101C probably benign Het
Maf1 T C 15: 76,352,157 probably benign Het
Map3k13 A T 16: 21,898,571 K185N possibly damaging Het
Mtus2 A T 5: 148,076,622 Q75L probably benign Het
Nod2 T A 8: 88,664,391 F427Y probably damaging Het
Olfr1496 A T 19: 13,780,911 I100F probably benign Het
Olfr470 A G 7: 107,845,262 L157P probably damaging Het
Pik3cg T C 12: 32,204,092 D632G probably damaging Het
Plekhs1 A G 19: 56,479,894 D298G probably benign Het
Rbm34 T C 8: 126,949,381 T375A probably benign Het
Slc4a7 C T 14: 14,765,665 T549I probably damaging Het
Soga3 T C 10: 29,147,355 S233P probably benign Het
Stk17b A G 1: 53,764,115 I47T probably damaging Het
Tenm2 C T 11: 36,024,624 V2028I probably benign Het
Tle4 A T 19: 14,517,938 H142Q probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpm2 T C 10: 77,929,219 I983V probably benign Het
Ttll8 C T 15: 88,915,580 A553T possibly damaging Het
Ubxn11 G T 4: 134,116,120 E171D possibly damaging Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18660604 missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18661358 missense probably benign
IGL00961:Arfgef3 APN 10 18611237 missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18652706 missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18600560 missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18594912 missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18603419 missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18743615 missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18591347 missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18646539 missense probably benign
IGL02400:Arfgef3 APN 10 18646257 missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18661392 splice site probably benign
IGL02815:Arfgef3 APN 10 18652551 missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18613225 missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18600544 missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18591882 missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18664912 missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18600490 missense probably damaging 1.00
Bow-wow UTSW 10 18646730 nonsense probably null
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18597407 missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18599214 missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18592281 missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18613127 splice site probably benign
R0417:Arfgef3 UTSW 10 18603511 missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18677815 splice site probably benign
R0507:Arfgef3 UTSW 10 18591621 missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18599288 missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18611290 missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18597431 missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18589666 missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18589735 missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18592118 missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18591375 missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18597348 missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18646554 missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18630879 missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18613222 nonsense probably null
R1564:Arfgef3 UTSW 10 18591704 missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18625148 missense probably null 0.15
R1868:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18597356 missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18652763 missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18592245 missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18616953 missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18597787 missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18677866 missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18592277 missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18619782 missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18625164 missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18607675 missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18600600 missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18608343 missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18646199 missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18634855 missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18654247 missense probably benign
R4801:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18646637 missense probably benign
R4828:Arfgef3 UTSW 10 18652693 missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18592186 missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18630851 missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18589706 missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18600460 missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18611237 missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18647798 splice site probably null
R5832:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18607665 nonsense probably null
R6272:Arfgef3 UTSW 10 18646963 missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18652841 missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18607665 nonsense probably null
R6495:Arfgef3 UTSW 10 18611202 critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18621155 missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18595019 missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18664889 critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18646730 nonsense probably null
R6941:Arfgef3 UTSW 10 18625455 missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18646439 missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18599267 missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18646462 missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18625391 missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18630835 missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18630463 missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18646259 missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18646629 missense probably benign
R7618:Arfgef3 UTSW 10 18646281 missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18595023 missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
R7934:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18652626 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18591437 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18608358 missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18634852 missense probably benign 0.26
Z1177:Arfgef3 UTSW 10 18607776 missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18627628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTGGTTCAGTGACAGGC -3'
(R):5'- CTCCTGTTAGCAAAGTAACTGC -3'

Sequencing Primer
(F):5'- GTCTCGAACCTGACACGGATAAG -3'
(R):5'- CTGTTAGCAAAGTAACTGCAGGGC -3'
Posted On2015-07-06