Mutagenetix > Incidental Mutation

Incidental Mutation 'R4395:Arfgef3'

325447

Institutional Source

Beutler Lab

Gene Symbol

Arfgef3

Ensembl Gene

ENSMUSG00000019852

Gene Name

ARFGEF family member 3

Synonyms

B930094H20Rik, D10Bwg1379e, BIG3

MMRRC Submission

041684-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R4395 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18581839-18743949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18597709 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1614 (L1614P)

Ref Sequence

ENSEMBL: ENSMUSP00000019999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]

AlphaFold

Q3UGY8

Predicted Effect

probably damaging
Transcript: ENSMUST00000019999
AA Change: L1614P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: L1614P

Domain	Start	End	E-Value	Type
Pfam:DCB	1	170	7.1e-15	PFAM
low complexity region	236	245	N/A	INTRINSIC
low complexity region	276	295	N/A	INTRINSIC
low complexity region	452	462	N/A	INTRINSIC
Sec7	582	794	6e-54	SMART
Blast:Sec7	798	873	3e-20	BLAST
low complexity region	927	940	N/A	INTRINSIC
Pfam:DUF1981	1237	1312	1.9e-14	PFAM
low complexity region	1641	1652	N/A	INTRINSIC
low complexity region	1710	1723	N/A	INTRINSIC
low complexity region	1838	1856	N/A	INTRINSIC
low complexity region	2088	2099	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215836
AA Change: L1614P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat1	A	G	4: 49,447,679	Y283H	probably benign	Het
Adamtsl5	A	G	10: 80,344,902	C109R	probably damaging	Het
Adgrg4	T	G	X: 56,932,343	L2193V	probably damaging	Het
Alpk3	C	T	7: 81,094,955	S1266F	probably damaging	Het
Atm	T	C	9: 53,465,227	R2038G	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Capza2	T	C	6: 17,656,450		probably null	Het
Cfap43	T	C	19: 47,751,913	T1274A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Cisd3	A	G	11: 97,688,386	Y115C	probably damaging	Het
Crebl2	A	G	6: 134,849,245	E53G	probably damaging	Het
Ech1	T	C	7: 28,826,246	S107P	probably damaging	Het
Fam3b	C	A	16: 97,481,786		probably null	Het
Fat1	T	A	8: 44,952,346	N711K	probably damaging	Het
Gm5724	T	C	6: 141,712,118	I565V	probably benign	Het
Grm8	T	A	6: 27,429,432	I488F	probably damaging	Het
Hmga2	C	T	10: 120,476,051	G5S	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Ifit3b	G	T	19: 34,612,551	E376*	probably null	Het
Ints5	A	G	19: 8,896,444	E589G	probably damaging	Het
Iqsec2	C	T	X: 152,209,053	T562I	probably damaging	Het
Lamc3	A	G	2: 31,931,952	E1304G	probably benign	Het
Ltv1	T	C	10: 13,190,579	Y101C	probably benign	Het
Maf1	T	C	15: 76,352,157		probably benign	Het
Map3k13	A	T	16: 21,898,571	K185N	possibly damaging	Het
Mtus2	A	T	5: 148,076,622	Q75L	probably benign	Het
Nod2	T	A	8: 88,664,391	F427Y	probably damaging	Het
Olfr1496	A	T	19: 13,780,911	I100F	probably benign	Het
Olfr470	A	G	7: 107,845,262	L157P	probably damaging	Het
Pik3cg	T	C	12: 32,204,092	D632G	probably damaging	Het
Plekhs1	A	G	19: 56,479,894	D298G	probably benign	Het
Rbm34	T	C	8: 126,949,381	T375A	probably benign	Het
Slc4a7	C	T	14: 14,765,665	T549I	probably damaging	Het
Soga3	T	C	10: 29,147,355	S233P	probably benign	Het
Stk17b	A	G	1: 53,764,115	I47T	probably damaging	Het
Tenm2	C	T	11: 36,024,624	V2028I	probably benign	Het
Tle4	A	T	19: 14,517,938	H142Q	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Trpm2	T	C	10: 77,929,219	I983V	probably benign	Het
Ttll8	C	T	15: 88,915,580	A553T	possibly damaging	Het
Ubxn11	G	T	4: 134,116,120	E171D	possibly damaging	Het

Other mutations in Arfgef3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Arfgef3	APN	10	18660604	missense	probably benign	0.03
IGL00835:Arfgef3	APN	10	18661358	missense	probably benign
IGL00961:Arfgef3	APN	10	18611237	missense	probably damaging	1.00
IGL01400:Arfgef3	APN	10	18652706	missense	probably damaging	1.00
IGL01501:Arfgef3	APN	10	18600560	missense	possibly damaging	0.93
IGL01595:Arfgef3	APN	10	18594912	missense	possibly damaging	0.93
IGL01695:Arfgef3	APN	10	18603419	missense	probably benign	0.00
IGL01774:Arfgef3	APN	10	18743615	missense	possibly damaging	0.94
IGL02348:Arfgef3	APN	10	18591347	missense	probably benign	0.04
IGL02371:Arfgef3	APN	10	18646539	missense	probably benign
IGL02400:Arfgef3	APN	10	18646257	missense	probably damaging	1.00
IGL02630:Arfgef3	APN	10	18661392	splice site	probably benign
IGL02815:Arfgef3	APN	10	18652551	missense	probably damaging	1.00
IGL03178:Arfgef3	APN	10	18613225	missense	probably damaging	1.00
IGL03182:Arfgef3	APN	10	18600544	missense	probably damaging	1.00
IGL03267:Arfgef3	APN	10	18591882	missense	probably damaging	1.00
IGL03294:Arfgef3	APN	10	18664912	missense	probably damaging	0.97
IGL03410:Arfgef3	APN	10	18600490	missense	probably damaging	1.00
Bow-wow	UTSW	10	18646730	nonsense	probably null
R0098:Arfgef3	UTSW	10	18589642	missense	probably damaging	1.00
R0098:Arfgef3	UTSW	10	18589642	missense	probably damaging	1.00
R0141:Arfgef3	UTSW	10	18597407	missense	probably damaging	1.00
R0164:Arfgef3	UTSW	10	18647915	missense	possibly damaging	0.77
R0164:Arfgef3	UTSW	10	18647915	missense	possibly damaging	0.77
R0241:Arfgef3	UTSW	10	18599214	missense	probably damaging	1.00
R0334:Arfgef3	UTSW	10	18592281	missense	probably damaging	0.98
R0352:Arfgef3	UTSW	10	18661387	missense	probably benign	0.17
R0415:Arfgef3	UTSW	10	18613127	splice site	probably benign
R0417:Arfgef3	UTSW	10	18603511	missense	probably damaging	1.00
R0442:Arfgef3	UTSW	10	18677815	splice site	probably benign
R0507:Arfgef3	UTSW	10	18591621	missense	probably damaging	1.00
R0573:Arfgef3	UTSW	10	18599288	missense	probably damaging	1.00
R0582:Arfgef3	UTSW	10	18611290	missense	probably damaging	1.00
R0609:Arfgef3	UTSW	10	18597431	missense	probably benign	0.31
R0826:Arfgef3	UTSW	10	18589666	missense	probably damaging	0.98
R0919:Arfgef3	UTSW	10	18589735	missense	possibly damaging	0.89
R0980:Arfgef3	UTSW	10	18592118	missense	possibly damaging	0.82
R1027:Arfgef3	UTSW	10	18591375	missense	probably benign	0.02
R1140:Arfgef3	UTSW	10	18597348	missense	possibly damaging	0.77
R1491:Arfgef3	UTSW	10	18646554	missense	probably damaging	1.00
R1493:Arfgef3	UTSW	10	18630879	missense	probably damaging	0.96
R1529:Arfgef3	UTSW	10	18613222	nonsense	probably null
R1564:Arfgef3	UTSW	10	18591704	missense	probably damaging	1.00
R1654:Arfgef3	UTSW	10	18625148	missense	probably null	0.15
R1868:Arfgef3	UTSW	10	18661387	missense	probably benign	0.17
R1876:Arfgef3	UTSW	10	18597356	missense	probably damaging	1.00
R1908:Arfgef3	UTSW	10	18652763	missense	possibly damaging	0.80
R2211:Arfgef3	UTSW	10	18592245	missense	possibly damaging	0.54
R2316:Arfgef3	UTSW	10	18616953	missense	probably benign	0.19
R2393:Arfgef3	UTSW	10	18597787	missense	possibly damaging	0.88
R2407:Arfgef3	UTSW	10	18677866	missense	possibly damaging	0.63
R3076:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R3077:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R3963:Arfgef3	UTSW	10	18592277	missense	probably damaging	1.00
R4201:Arfgef3	UTSW	10	18619782	missense	probably benign	0.01
R4241:Arfgef3	UTSW	10	18625164	missense	probably damaging	1.00
R4244:Arfgef3	UTSW	10	18630420	missense	probably damaging	1.00
R4455:Arfgef3	UTSW	10	18607675	missense	probably benign	0.18
R4480:Arfgef3	UTSW	10	18600600	missense	probably damaging	1.00
R4499:Arfgef3	UTSW	10	18608343	missense	possibly damaging	0.95
R4589:Arfgef3	UTSW	10	18646199	missense	probably damaging	1.00
R4635:Arfgef3	UTSW	10	18634855	missense	probably damaging	1.00
R4776:Arfgef3	UTSW	10	18654247	missense	probably benign
R4801:Arfgef3	UTSW	10	18591906	missense	probably benign	0.00
R4802:Arfgef3	UTSW	10	18591906	missense	probably benign	0.00
R4807:Arfgef3	UTSW	10	18646637	missense	probably benign
R4828:Arfgef3	UTSW	10	18652693	missense	probably damaging	0.99
R4861:Arfgef3	UTSW	10	18607731	missense	probably benign	0.01
R4861:Arfgef3	UTSW	10	18607731	missense	probably benign	0.01
R4917:Arfgef3	UTSW	10	18616890	missense	probably damaging	0.99
R4918:Arfgef3	UTSW	10	18616890	missense	probably damaging	0.99
R4922:Arfgef3	UTSW	10	18592186	missense	probably damaging	0.97
R4929:Arfgef3	UTSW	10	18630851	missense	probably benign	0.00
R4937:Arfgef3	UTSW	10	18589706	missense	probably damaging	0.98
R5290:Arfgef3	UTSW	10	18600460	missense	probably damaging	1.00
R5410:Arfgef3	UTSW	10	18611237	missense	probably damaging	0.99
R5807:Arfgef3	UTSW	10	18647798	splice site	probably null
R5832:Arfgef3	UTSW	10	18630420	missense	probably damaging	1.00
R5887:Arfgef3	UTSW	10	18607665	nonsense	probably null
R6272:Arfgef3	UTSW	10	18646963	missense	probably benign	0.00
R6302:Arfgef3	UTSW	10	18652841	missense	probably damaging	0.97
R6397:Arfgef3	UTSW	10	18607665	nonsense	probably null
R6495:Arfgef3	UTSW	10	18611202	critical splice donor site	probably null
R6707:Arfgef3	UTSW	10	18621155	missense	probably benign	0.11
R6814:Arfgef3	UTSW	10	18595019	missense	probably damaging	1.00
R6830:Arfgef3	UTSW	10	18664889	critical splice donor site	probably null
R6870:Arfgef3	UTSW	10	18646730	nonsense	probably null
R6941:Arfgef3	UTSW	10	18625455	missense	possibly damaging	0.66
R7094:Arfgef3	UTSW	10	18646439	missense	probably damaging	1.00
R7179:Arfgef3	UTSW	10	18599267	missense	probably damaging	1.00
R7204:Arfgef3	UTSW	10	18646462	missense	probably damaging	1.00
R7247:Arfgef3	UTSW	10	18625391	missense	probably benign	0.00
R7249:Arfgef3	UTSW	10	18630835	missense	possibly damaging	0.62
R7318:Arfgef3	UTSW	10	18630463	missense	possibly damaging	0.89
R7391:Arfgef3	UTSW	10	18646259	missense	probably benign	0.05
R7527:Arfgef3	UTSW	10	18646629	missense	probably benign
R7618:Arfgef3	UTSW	10	18646281	missense	probably damaging	1.00
R7779:Arfgef3	UTSW	10	18595023	missense	probably damaging	0.99
R7851:Arfgef3	UTSW	10	18592286	missense	probably damaging	1.00
R8112:Arfgef3	UTSW	10	18652631	missense	possibly damaging	0.96
R8133:Arfgef3	UTSW	10	18611203	critical splice donor site	probably null
R8242:Arfgef3	UTSW	10	18630076	missense	probably benign	0.25
R8369:Arfgef3	UTSW	10	18589729	missense	probably benign	0.34
R8396:Arfgef3	UTSW	10	18652532	critical splice donor site	probably null
R8553:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R8798:Arfgef3	UTSW	10	18647051	missense	probably damaging	1.00
R8821:Arfgef3	UTSW	10	18652743	missense	possibly damaging	0.95
R8831:Arfgef3	UTSW	10	18652743	missense	possibly damaging	0.95
R8918:Arfgef3	UTSW	10	18635705	missense	probably benign	0.01
R8929:Arfgef3	UTSW	10	18603455	missense	probably damaging	1.00
R9001:Arfgef3	UTSW	10	18646728	missense	probably benign	0.32
R9077:Arfgef3	UTSW	10	18625151	missense	possibly damaging	0.81
R9258:Arfgef3	UTSW	10	18589639	missense	probably damaging	1.00
R9267:Arfgef3	UTSW	10	18599280	missense	probably damaging	1.00
R9358:Arfgef3	UTSW	10	18616880	missense	probably damaging	1.00
R9388:Arfgef3	UTSW	10	18630129	missense	probably benign	0.35
R9389:Arfgef3	UTSW	10	18603523	missense	probably damaging	1.00
R9563:Arfgef3	UTSW	10	18646527	missense	probably damaging	1.00
R9713:Arfgef3	UTSW	10	18652808	missense	probably damaging	1.00
X0026:Arfgef3	UTSW	10	18652626	missense	probably damaging	1.00
Z1176:Arfgef3	UTSW	10	18591437	missense	probably damaging	1.00
Z1176:Arfgef3	UTSW	10	18608358	missense	probably damaging	0.97
Z1176:Arfgef3	UTSW	10	18634852	missense	probably benign	0.26
Z1177:Arfgef3	UTSW	10	18607776	missense	probably damaging	1.00
Z1177:Arfgef3	UTSW	10	18627628	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTTGGTTCAGTGACAGGC -3'
(R):5'- CTCCTGTTAGCAAAGTAACTGC -3'

Sequencing Primer
(F):5'- GTCTCGAACCTGACACGGATAAG -3'
(R):5'- CTGTTAGCAAAGTAACTGCAGGGC -3'

Posted On

2015-07-06