Mutagenetix > Incidental Mutation

Incidental Mutation 'R4395:Trpm2'

325449

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

041684-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R4395 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77929219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 983 (I983V)

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105400

Predicted Effect

probably benign
Transcript: ENSMUST00000105401
AA Change: I983V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: I983V

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126206

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140471

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217806

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat1	A	G	4: 49,447,679	Y283H	probably benign	Het
Adamtsl5	A	G	10: 80,344,902	C109R	probably damaging	Het
Adgrg4	T	G	X: 56,932,343	L2193V	probably damaging	Het
Alpk3	C	T	7: 81,094,955	S1266F	probably damaging	Het
Arfgef3	A	G	10: 18,597,709	L1614P	probably damaging	Het
Atm	T	C	9: 53,465,227	R2038G	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Capza2	T	C	6: 17,656,450		probably null	Het
Cfap43	T	C	19: 47,751,913	T1274A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Cisd3	A	G	11: 97,688,386	Y115C	probably damaging	Het
Crebl2	A	G	6: 134,849,245	E53G	probably damaging	Het
Ech1	T	C	7: 28,826,246	S107P	probably damaging	Het
Fam3b	C	A	16: 97,481,786		probably null	Het
Fat1	T	A	8: 44,952,346	N711K	probably damaging	Het
Gm5724	T	C	6: 141,712,118	I565V	probably benign	Het
Grm8	T	A	6: 27,429,432	I488F	probably damaging	Het
Hmga2	C	T	10: 120,476,051	G5S	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Ifit3b	G	T	19: 34,612,551	E376*	probably null	Het
Ints5	A	G	19: 8,896,444	E589G	probably damaging	Het
Iqsec2	C	T	X: 152,209,053	T562I	probably damaging	Het
Lamc3	A	G	2: 31,931,952	E1304G	probably benign	Het
Ltv1	T	C	10: 13,190,579	Y101C	probably benign	Het
Maf1	T	C	15: 76,352,157		probably benign	Het
Map3k13	A	T	16: 21,898,571	K185N	possibly damaging	Het
Mtus2	A	T	5: 148,076,622	Q75L	probably benign	Het
Nod2	T	A	8: 88,664,391	F427Y	probably damaging	Het
Olfr1496	A	T	19: 13,780,911	I100F	probably benign	Het
Olfr470	A	G	7: 107,845,262	L157P	probably damaging	Het
Pik3cg	T	C	12: 32,204,092	D632G	probably damaging	Het
Plekhs1	A	G	19: 56,479,894	D298G	probably benign	Het
Rbm34	T	C	8: 126,949,381	T375A	probably benign	Het
Slc4a7	C	T	14: 14,765,665	T549I	probably damaging	Het
Soga3	T	C	10: 29,147,355	S233P	probably benign	Het
Stk17b	A	G	1: 53,764,115	I47T	probably damaging	Het
Tenm2	C	T	11: 36,024,624	V2028I	probably benign	Het
Tle4	A	T	19: 14,517,938	H142Q	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Ttll8	C	T	15: 88,915,580	A553T	possibly damaging	Het
Ubxn11	G	T	4: 134,116,120	E171D	possibly damaging	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77947897	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77936002	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77966025	nonsense	probably null
R8340:Trpm2	UTSW	10	77923624	nonsense	probably null
R8354:Trpm2	UTSW	10	77933649	missense	probably damaging	1.00
R8427:Trpm2	UTSW	10	77911402	missense	possibly damaging	0.93
R8445:Trpm2	UTSW	10	77910252	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77932294	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77929288	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77941180	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77942942	nonsense	probably null
R9319:Trpm2	UTSW	10	77949198	missense	probably damaging	1.00
R9381:Trpm2	UTSW	10	77911357	missense	possibly damaging	0.90
R9457:Trpm2	UTSW	10	77911392	missense	possibly damaging	0.82
R9477:Trpm2	UTSW	10	77911390	missense	probably benign	0.12
R9547:Trpm2	UTSW	10	77912633	missense	probably benign	0.33
R9660:Trpm2	UTSW	10	77930555	missense	probably benign	0.00
R9663:Trpm2	UTSW	10	77920486	missense	probably benign	0.01
Z1177:Trpm2	UTSW	10	77937868	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ACCTTCACTCTCTGTTGGGG -3'
(R):5'- GGGTGCAACCTGTTGTTTCAC -3'

Sequencing Primer
(F):5'- TCAACATCCAAGGCAAGCTG -3'
(R):5'- TTCACTCTCTGCAGATGAAGGACG -3'

Posted On

2015-07-06