Incidental Mutation 'R4395:Cisd3'
ID325453
Institutional Source Beutler Lab
Gene Symbol Cisd3
Ensembl Gene ENSMUSG00000078695
Gene NameCDGSH iron sulfur domain 3
SynonymsMel13
MMRRC Submission 041684-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R4395 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location97685826-97688621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97688386 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 115 (Y115C)
Ref Sequence ENSEMBL: ENSMUSP00000103211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018681] [ENSMUST00000044730] [ENSMUST00000103148] [ENSMUST00000103149] [ENSMUST00000107583] [ENSMUST00000107584] [ENSMUST00000107585] [ENSMUST00000107586] [ENSMUST00000169807] [ENSMUST00000179765]
Predicted Effect probably benign
Transcript: ENSMUST00000018681
SMART Domains Protein: ENSMUSP00000018681
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044730
SMART Domains Protein: ENSMUSP00000045445
Gene: ENSMUSG00000038437

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 520 536 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
coiled coil region 703 744 N/A INTRINSIC
low complexity region 746 756 N/A INTRINSIC
low complexity region 773 782 N/A INTRINSIC
low complexity region 802 848 N/A INTRINSIC
low complexity region 860 901 N/A INTRINSIC
coiled coil region 915 942 N/A INTRINSIC
low complexity region 995 1018 N/A INTRINSIC
low complexity region 1026 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103148
SMART Domains Protein: ENSMUSP00000099437
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103149
SMART Domains Protein: ENSMUSP00000099438
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
low complexity region 79 134 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107583
AA Change: Y118C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103209
Gene: ENSMUSG00000078695
AA Change: Y118C

DomainStartEndE-ValueType
ZnF_CDGSH 54 88 3.39e-9 SMART
ZnF_CDGSH 92 129 5.55e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107584
AA Change: Y96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103210
Gene: ENSMUSG00000078695
AA Change: Y96C

DomainStartEndE-ValueType
ZnF_CDGSH 32 66 3.39e-9 SMART
ZnF_CDGSH 70 107 5.55e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107585
AA Change: Y115C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103211
Gene: ENSMUSG00000078695
AA Change: Y115C

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
ZnF_CDGSH 51 85 3.39e-9 SMART
ZnF_CDGSH 89 126 5.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107586
SMART Domains Protein: ENSMUSP00000103212
Gene: ENSMUSG00000038437

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 336 356 N/A INTRINSIC
low complexity region 388 410 N/A INTRINSIC
low complexity region 428 442 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
low complexity region 532 546 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 609 631 N/A INTRINSIC
low complexity region 679 696 N/A INTRINSIC
coiled coil region 733 774 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
low complexity region 803 812 N/A INTRINSIC
low complexity region 832 878 N/A INTRINSIC
low complexity region 890 931 N/A INTRINSIC
coiled coil region 945 972 N/A INTRINSIC
low complexity region 1025 1048 N/A INTRINSIC
low complexity region 1056 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145623
Predicted Effect probably benign
Transcript: ENSMUST00000169807
SMART Domains Protein: ENSMUSP00000126967
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
Pfam:RAWUL 146 228 1.9e-26 PFAM
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179765
SMART Domains Protein: ENSMUSP00000137517
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,679 Y283H probably benign Het
Adamtsl5 A G 10: 80,344,902 C109R probably damaging Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Alpk3 C T 7: 81,094,955 S1266F probably damaging Het
Arfgef3 A G 10: 18,597,709 L1614P probably damaging Het
Atm T C 9: 53,465,227 R2038G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Capza2 T C 6: 17,656,450 probably null Het
Cfap43 T C 19: 47,751,913 T1274A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crebl2 A G 6: 134,849,245 E53G probably damaging Het
Ech1 T C 7: 28,826,246 S107P probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Gm5724 T C 6: 141,712,118 I565V probably benign Het
Grm8 T A 6: 27,429,432 I488F probably damaging Het
Hmga2 C T 10: 120,476,051 G5S probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Ifit3b G T 19: 34,612,551 E376* probably null Het
Ints5 A G 19: 8,896,444 E589G probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Ltv1 T C 10: 13,190,579 Y101C probably benign Het
Maf1 T C 15: 76,352,157 probably benign Het
Map3k13 A T 16: 21,898,571 K185N possibly damaging Het
Mtus2 A T 5: 148,076,622 Q75L probably benign Het
Nod2 T A 8: 88,664,391 F427Y probably damaging Het
Olfr1496 A T 19: 13,780,911 I100F probably benign Het
Olfr470 A G 7: 107,845,262 L157P probably damaging Het
Pik3cg T C 12: 32,204,092 D632G probably damaging Het
Plekhs1 A G 19: 56,479,894 D298G probably benign Het
Rbm34 T C 8: 126,949,381 T375A probably benign Het
Slc4a7 C T 14: 14,765,665 T549I probably damaging Het
Soga3 T C 10: 29,147,355 S233P probably benign Het
Stk17b A G 1: 53,764,115 I47T probably damaging Het
Tenm2 C T 11: 36,024,624 V2028I probably benign Het
Tle4 A T 19: 14,517,938 H142Q probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpm2 T C 10: 77,929,219 I983V probably benign Het
Ttll8 C T 15: 88,915,580 A553T possibly damaging Het
Ubxn11 G T 4: 134,116,120 E171D possibly damaging Het
Other mutations in Cisd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4131:Cisd3 UTSW 11 97688431 missense possibly damaging 0.56
R6950:Cisd3 UTSW 11 97686160 intron probably null
R7176:Cisd3 UTSW 11 97686133 missense probably benign
R8063:Cisd3 UTSW 11 97685884 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGAAACGAGAATGCTCCACTC -3'
(R):5'- AGGCCTCAGTGTTTATTGACAG -3'

Sequencing Primer
(F):5'- GAGAATGCTCCACTCCCCAC -3'
(R):5'- ATTGACAGCTTTACCGGATGC -3'
Posted On2015-07-06