Incidental Mutation 'R0012:Mthfd2l'
ID32546
Institutional Source Beutler Lab
Gene Symbol Mthfd2l
Ensembl Gene ENSMUSG00000029376
Gene Namemethylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
SynonymsC630010D07Rik, 1110019K23Rik
MMRRC Submission 038307-MU
Accession Numbers

Genbank: NM_026788; MGI: 1915871

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0012 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location90931117-91021368 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90961383 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 224 (H224L)
Ref Sequence ENSEMBL: ENSMUSP00000071578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071652]
Predicted Effect probably damaging
Transcript: ENSMUST00000071652
AA Change: H224L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071578
Gene: ENSMUSG00000029376
AA Change: H224L

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:THF_DHG_CYH 44 160 1.4e-40 PFAM
Pfam:THF_DHG_CYH_C 163 337 4.5e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201851
Meta Mutation Damage Score 0.3570 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 98% (81/83)
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 A T 2: 131,052,920 L687Q probably damaging Het
Adap1 A G 5: 139,307,734 probably benign Het
Add2 T A 6: 86,098,628 V253E probably damaging Het
Agtr1a A T 13: 30,381,749 I266F probably damaging Het
Anxa9 A G 3: 95,308,095 probably benign Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Asna1 T C 8: 85,025,096 probably benign Het
Bnip3 A G 7: 138,898,672 probably benign Het
Brwd1 A C 16: 96,059,652 S311R probably damaging Het
C2cd3 G A 7: 100,418,522 V871M possibly damaging Het
Cacul1 A G 19: 60,564,253 W145R probably damaging Het
Celf5 C A 10: 81,469,512 V141L probably damaging Het
Cfap206 C A 4: 34,714,519 L392F possibly damaging Het
Chd2 G T 7: 73,455,519 T192K probably damaging Het
Chrna10 T C 7: 102,115,057 N40S possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clspn T A 4: 126,564,929 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col5a3 A T 9: 20,777,108 probably benign Het
Copb1 T A 7: 114,237,408 K366N probably damaging Het
Cul9 G A 17: 46,538,510 R570C probably benign Het
Cyp2c70 A T 19: 40,187,243 L7Q probably null Het
Dock2 T C 11: 34,783,795 E10G possibly damaging Het
Dpysl4 T G 7: 139,097,883 I412S probably benign Het
Eaf2 T A 16: 36,808,174 probably benign Het
Fasl T C 1: 161,788,164 D41G probably benign Het
Fat2 A G 11: 55,262,871 V3505A probably benign Het
Fbxo24 A G 5: 137,621,994 F101S probably damaging Het
Fdft1 T C 14: 63,177,698 I28M probably benign Het
Gcnt3 T C 9: 70,034,085 I400M probably benign Het
Gpd2 T A 2: 57,338,868 M228K probably damaging Het
Gsap T A 5: 21,226,229 probably benign Het
Hipk1 A G 3: 103,763,680 M467T probably damaging Het
Hmgb4 T A 4: 128,260,725 I17F probably damaging Het
Ints10 C A 8: 68,807,475 L284M probably benign Het
Kif17 T G 4: 138,293,748 S606A probably damaging Het
Lifr C A 15: 7,175,608 T442K possibly damaging Het
Lypd4 A G 7: 24,865,332 L127P probably damaging Het
Lyst A G 13: 13,687,694 H2605R probably benign Het
Map3k4 A G 17: 12,238,189 S1289P probably damaging Het
Mgam T A 6: 40,765,256 probably null Het
Mob1b G A 5: 88,756,084 probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Ms4a4c C A 19: 11,418,980 probably benign Het
Myh8 T C 11: 67,300,021 Y1350H probably benign Het
Nectin2 T C 7: 19,730,744 probably benign Het
Nos1 A C 5: 117,893,902 N305T probably damaging Het
Ogfrl1 T A 1: 23,370,125 Q340L possibly damaging Het
Olfr1318 A T 2: 112,156,826 N292Y possibly damaging Het
Olfr1502 C A 19: 13,861,823 T10K probably damaging Het
Olfr170 T C 16: 19,606,440 N76S probably benign Het
Olfr427 T G 1: 174,100,207 F250V probably damaging Het
Orc1 T C 4: 108,595,646 probably null Het
Plekhg5 C A 4: 152,104,750 D249E probably benign Het
Plet1 A G 9: 50,499,130 I74V probably benign Het
Psmd2 T A 16: 20,661,684 D718E probably damaging Het
Rab33b G T 3: 51,484,316 probably benign Het
Rae1 T A 2: 173,002,673 F4I unknown Het
Ralgapa2 A G 2: 146,412,752 Y821H probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sharpin G T 15: 76,348,343 P156T possibly damaging Het
Slc38a4 C T 15: 96,999,629 R435H probably damaging Het
Snrnp200 T C 2: 127,228,549 V1061A probably benign Het
Suclg1 A G 6: 73,270,997 T234A possibly damaging Het
Swsap1 T C 9: 21,957,022 C197R probably benign Het
Tbx15 A G 3: 99,352,096 T428A probably benign Het
Tet2 T C 3: 133,476,558 Y1215C probably damaging Het
Tjp1 A G 7: 65,329,775 probably benign Het
Tmem209 G T 6: 30,502,113 probably benign Het
Tnpo3 T C 6: 29,589,177 E58G probably damaging Het
Trp53bp2 T A 1: 182,444,718 M464K probably damaging Het
Ttc32 A G 12: 9,035,897 Y148C possibly damaging Het
Unc80 T C 1: 66,507,391 S541P probably damaging Het
Ushbp1 T C 8: 71,395,040 probably benign Het
Vmn2r100 A G 17: 19,504,874 M22V probably benign Het
Vmn2r100 A T 17: 19,526,034 E485V probably damaging Het
Wdr24 G A 17: 25,827,113 V471I probably benign Het
Zfp35 T A 18: 24,002,944 M115K probably benign Het
Zfp429 G A 13: 67,390,677 S216L probably benign Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Mthfd2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Mthfd2l APN 5 91000566 missense possibly damaging 0.95
IGL03306:Mthfd2l APN 5 91020208 missense probably damaging 1.00
3-1:Mthfd2l UTSW 5 90946834 missense probably damaging 1.00
R0012:Mthfd2l UTSW 5 90961383 missense probably damaging 1.00
R0457:Mthfd2l UTSW 5 91020206 missense possibly damaging 0.82
R0458:Mthfd2l UTSW 5 91020177 missense probably damaging 1.00
R0744:Mthfd2l UTSW 5 90946942 missense probably damaging 1.00
R0833:Mthfd2l UTSW 5 90946942 missense probably damaging 1.00
R1771:Mthfd2l UTSW 5 90974395 missense probably damaging 1.00
R2226:Mthfd2l UTSW 5 90948834 nonsense probably null
R4679:Mthfd2l UTSW 5 90948911 missense probably benign 0.05
R4771:Mthfd2l UTSW 5 90948868 missense possibly damaging 0.94
R5437:Mthfd2l UTSW 5 90948898 missense possibly damaging 0.54
R7008:Mthfd2l UTSW 5 90959728 missense probably damaging 1.00
R7198:Mthfd2l UTSW 5 90946846 missense probably damaging 0.99
R7654:Mthfd2l UTSW 5 90946806 missense probably damaging 1.00
R8018:Mthfd2l UTSW 5 90959813 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGAAACTTGGTGTTCAAAAGGACT -3'
(R):5'- GATCAAAGAGGCCACATATTTCCAGCA -3'

Sequencing Primer
(F):5'- CTTGGTGTTCAAAAGGACTTTACTG -3'
(R):5'- agtatcaaaagcctcctgcc -3'
Posted On2013-05-09