Incidental Mutation 'R4395:Tle4'
ID325466
Institutional Source Beutler Lab
Gene Symbol Tle4
Ensembl Gene ENSMUSG00000024642
Gene Nametransducin-like enhancer of split 4
SynonymsBce1, ESTM14, 5730411M05Rik, Grg4, ESTM13
MMRRC Submission 041684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4395 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location14448072-14598051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14517938 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 142 (H142Q)
Ref Sequence ENSEMBL: ENSMUSP00000057527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052011] [ENSMUST00000167776]
Predicted Effect probably benign
Transcript: ENSMUST00000052011
AA Change: H142Q

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000057527
Gene: ENSMUSG00000024642
AA Change: H142Q

DomainStartEndE-ValueType
Pfam:TLE_N 8 138 9.1e-76 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
low complexity region 226 238 N/A INTRINSIC
low complexity region 289 316 N/A INTRINSIC
WD40 477 514 4.18e-2 SMART
WD40 520 561 3.64e-2 SMART
WD40 566 605 9.38e-5 SMART
WD40 608 647 1.14e-8 SMART
WD40 650 688 2.29e1 SMART
WD40 690 729 7.39e-3 SMART
WD40 730 770 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167776
AA Change: H142Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126249
Gene: ENSMUSG00000024642
AA Change: H142Q

DomainStartEndE-ValueType
Pfam:TLE_N 8 138 5.1e-76 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 199 216 N/A INTRINSIC
low complexity region 226 238 N/A INTRINSIC
low complexity region 289 316 N/A INTRINSIC
WD40 477 514 4.18e-2 SMART
WD40 520 561 3.64e-2 SMART
WD40 566 605 9.38e-5 SMART
WD40 608 647 1.14e-8 SMART
WD40 650 688 2.29e1 SMART
WD40 690 729 7.39e-3 SMART
WD40 730 770 4.14e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are runted and die around 4 weeks of age with leukocytopenia, B cell lymphopenia, reduced bone mineralization and reduced hematopoietic stem cell number and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,679 Y283H probably benign Het
Adamtsl5 A G 10: 80,344,902 C109R probably damaging Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Alpk3 C T 7: 81,094,955 S1266F probably damaging Het
Arfgef3 A G 10: 18,597,709 L1614P probably damaging Het
Atm T C 9: 53,465,227 R2038G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Capza2 T C 6: 17,656,450 probably null Het
Cfap43 T C 19: 47,751,913 T1274A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cisd3 A G 11: 97,688,386 Y115C probably damaging Het
Crebl2 A G 6: 134,849,245 E53G probably damaging Het
Ech1 T C 7: 28,826,246 S107P probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Gm5724 T C 6: 141,712,118 I565V probably benign Het
Grm8 T A 6: 27,429,432 I488F probably damaging Het
Hmga2 C T 10: 120,476,051 G5S probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Ifit3b G T 19: 34,612,551 E376* probably null Het
Ints5 A G 19: 8,896,444 E589G probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Ltv1 T C 10: 13,190,579 Y101C probably benign Het
Maf1 T C 15: 76,352,157 probably benign Het
Map3k13 A T 16: 21,898,571 K185N possibly damaging Het
Mtus2 A T 5: 148,076,622 Q75L probably benign Het
Nod2 T A 8: 88,664,391 F427Y probably damaging Het
Olfr1496 A T 19: 13,780,911 I100F probably benign Het
Olfr470 A G 7: 107,845,262 L157P probably damaging Het
Pik3cg T C 12: 32,204,092 D632G probably damaging Het
Plekhs1 A G 19: 56,479,894 D298G probably benign Het
Rbm34 T C 8: 126,949,381 T375A probably benign Het
Slc4a7 C T 14: 14,765,665 T549I probably damaging Het
Soga3 T C 10: 29,147,355 S233P probably benign Het
Stk17b A G 1: 53,764,115 I47T probably damaging Het
Tenm2 C T 11: 36,024,624 V2028I probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpm2 T C 10: 77,929,219 I983V probably benign Het
Ttll8 C T 15: 88,915,580 A553T possibly damaging Het
Ubxn11 G T 4: 134,116,120 E171D possibly damaging Het
Other mutations in Tle4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tle4 APN 19 14468261 missense probably benign 0.00
IGL01449:Tle4 APN 19 14465340 missense probably benign 0.00
IGL01618:Tle4 APN 19 14544814 missense probably benign 0.07
IGL01636:Tle4 APN 19 14452533 missense probably damaging 0.97
IGL01750:Tle4 APN 19 14449789 missense probably damaging 1.00
IGL02376:Tle4 APN 19 14594404 missense probably damaging 1.00
R0006:Tle4 UTSW 19 14466714 splice site probably benign
R1068:Tle4 UTSW 19 14452179 missense probably damaging 1.00
R1174:Tle4 UTSW 19 14468262 missense probably benign
R1594:Tle4 UTSW 19 14453606 nonsense probably null
R1671:Tle4 UTSW 19 14453739 missense probably damaging 1.00
R1891:Tle4 UTSW 19 14544786 critical splice donor site probably null
R1951:Tle4 UTSW 19 14516357 critical splice donor site probably null
R2068:Tle4 UTSW 19 14449749 nonsense probably null
R3858:Tle4 UTSW 19 14468213 missense probably benign 0.11
R3859:Tle4 UTSW 19 14468213 missense probably benign 0.11
R3946:Tle4 UTSW 19 14597388 missense probably damaging 0.98
R4357:Tle4 UTSW 19 14468261 missense probably benign 0.00
R4491:Tle4 UTSW 19 14454865 missense probably damaging 1.00
R4860:Tle4 UTSW 19 14464345 missense probably benign 0.30
R4860:Tle4 UTSW 19 14464345 missense probably benign 0.30
R5336:Tle4 UTSW 19 14454739 critical splice donor site probably null
R5516:Tle4 UTSW 19 14454889 missense probably damaging 0.99
R5611:Tle4 UTSW 19 14449795 missense probably damaging 1.00
R6032:Tle4 UTSW 19 14452108 missense possibly damaging 0.74
R6032:Tle4 UTSW 19 14452108 missense possibly damaging 0.74
R6113:Tle4 UTSW 19 14595588 critical splice donor site probably null
R6513:Tle4 UTSW 19 14451692 missense probably damaging 0.99
R6995:Tle4 UTSW 19 14564453 critical splice acceptor site probably null
R7175:Tle4 UTSW 19 14451707 missense probably damaging 1.00
R7310:Tle4 UTSW 19 14517791 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAATGCCCACTCACCTCTTTGG -3'
(R):5'- GCAACATCAGTTATGCATCTTTCC -3'

Sequencing Primer
(F):5'- CCTCTTTGGTGATCATTGTCATG -3'
(R):5'- CCCTCTCCCAACTTTAAAAATGATTC -3'
Posted On2015-07-06