Incidental Mutation 'R4395:Iqsec2'
ID325470
Institutional Source Beutler Lab
Gene Symbol Iqsec2
Ensembl Gene ENSMUSG00000041115
Gene NameIQ motif and Sec7 domain 2
Synonyms
MMRRC Submission 041684-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R4395 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location152144268-152225236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152209053 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 562 (T562I)
Ref Sequence ENSEMBL: ENSMUSP00000127249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096275] [ENSMUST00000112604] [ENSMUST00000112605] [ENSMUST00000168786]
Predicted Effect probably benign
Transcript: ENSMUST00000096275
AA Change: T357I

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093995
Gene: ENSMUSG00000041115
AA Change: T357I

DomainStartEndE-ValueType
low complexity region 164 177 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
low complexity region 309 334 N/A INTRINSIC
low complexity region 343 355 N/A INTRINSIC
low complexity region 395 410 N/A INTRINSIC
low complexity region 444 461 N/A INTRINSIC
low complexity region 491 515 N/A INTRINSIC
Sec7 545 736 2.19e-88 SMART
PH 767 878 6.87e-3 SMART
Blast:Sec7 886 931 3e-18 BLAST
low complexity region 932 946 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112604
AA Change: T562I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108223
Gene: ENSMUSG00000041115
AA Change: T562I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
coiled coil region 23 74 N/A INTRINSIC
low complexity region 167 174 N/A INTRINSIC
low complexity region 206 232 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
low complexity region 433 451 N/A INTRINSIC
low complexity region 514 539 N/A INTRINSIC
low complexity region 548 560 N/A INTRINSIC
low complexity region 600 615 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
low complexity region 696 720 N/A INTRINSIC
Sec7 750 941 2.19e-88 SMART
PH 972 1083 6.87e-3 SMART
Blast:Sec7 1091 1136 3e-18 BLAST
low complexity region 1137 1151 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112605
AA Change: T562I

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108224
Gene: ENSMUSG00000041115
AA Change: T562I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
coiled coil region 23 74 N/A INTRINSIC
low complexity region 167 174 N/A INTRINSIC
low complexity region 206 232 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
low complexity region 433 451 N/A INTRINSIC
low complexity region 514 539 N/A INTRINSIC
low complexity region 548 560 N/A INTRINSIC
low complexity region 600 615 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
low complexity region 696 720 N/A INTRINSIC
Sec7 750 941 2.19e-88 SMART
PH 972 1083 6.87e-3 SMART
Blast:Sec7 1091 1136 4e-18 BLAST
low complexity region 1137 1151 N/A INTRINSIC
low complexity region 1201 1211 N/A INTRINSIC
low complexity region 1228 1253 N/A INTRINSIC
low complexity region 1273 1318 N/A INTRINSIC
low complexity region 1337 1349 N/A INTRINSIC
low complexity region 1392 1462 N/A INTRINSIC
low complexity region 1470 1482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168786
AA Change: T562I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127249
Gene: ENSMUSG00000041115
AA Change: T562I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
coiled coil region 23 74 N/A INTRINSIC
low complexity region 167 174 N/A INTRINSIC
low complexity region 206 232 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
low complexity region 433 451 N/A INTRINSIC
low complexity region 514 539 N/A INTRINSIC
low complexity region 548 560 N/A INTRINSIC
low complexity region 600 615 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
low complexity region 696 720 N/A INTRINSIC
Sec7 750 941 2.19e-88 SMART
Blast:PH 972 1074 7e-61 BLAST
Blast:Sec7 1082 1127 4e-18 BLAST
low complexity region 1128 1142 N/A INTRINSIC
low complexity region 1192 1202 N/A INTRINSIC
low complexity region 1219 1244 N/A INTRINSIC
low complexity region 1264 1309 N/A INTRINSIC
low complexity region 1328 1340 N/A INTRINSIC
low complexity region 1383 1453 N/A INTRINSIC
low complexity region 1461 1473 N/A INTRINSIC
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor for the ARF family of small GTP-binding proteins. The encoded protein is a component of the postsynaptic density at excitatory synapses, and may play a critical role in cytoskeletal and synaptic organization through the activation of selected ARF substrates including ARF1 and ARF6. Mutations in this gene have been implicated in nonsyndromic X-linked mental retardation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,679 Y283H probably benign Het
Adamtsl5 A G 10: 80,344,902 C109R probably damaging Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Alpk3 C T 7: 81,094,955 S1266F probably damaging Het
Arfgef3 A G 10: 18,597,709 L1614P probably damaging Het
Atm T C 9: 53,465,227 R2038G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Capza2 T C 6: 17,656,450 probably null Het
Cfap43 T C 19: 47,751,913 T1274A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cisd3 A G 11: 97,688,386 Y115C probably damaging Het
Crebl2 A G 6: 134,849,245 E53G probably damaging Het
Ech1 T C 7: 28,826,246 S107P probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Gm5724 T C 6: 141,712,118 I565V probably benign Het
Grm8 T A 6: 27,429,432 I488F probably damaging Het
Hmga2 C T 10: 120,476,051 G5S probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Ifit3b G T 19: 34,612,551 E376* probably null Het
Ints5 A G 19: 8,896,444 E589G probably damaging Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Ltv1 T C 10: 13,190,579 Y101C probably benign Het
Maf1 T C 15: 76,352,157 probably benign Het
Map3k13 A T 16: 21,898,571 K185N possibly damaging Het
Mtus2 A T 5: 148,076,622 Q75L probably benign Het
Nod2 T A 8: 88,664,391 F427Y probably damaging Het
Olfr1496 A T 19: 13,780,911 I100F probably benign Het
Olfr470 A G 7: 107,845,262 L157P probably damaging Het
Pik3cg T C 12: 32,204,092 D632G probably damaging Het
Plekhs1 A G 19: 56,479,894 D298G probably benign Het
Rbm34 T C 8: 126,949,381 T375A probably benign Het
Slc4a7 C T 14: 14,765,665 T549I probably damaging Het
Soga3 T C 10: 29,147,355 S233P probably benign Het
Stk17b A G 1: 53,764,115 I47T probably damaging Het
Tenm2 C T 11: 36,024,624 V2028I probably benign Het
Tle4 A T 19: 14,517,938 H142Q probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpm2 T C 10: 77,929,219 I983V probably benign Het
Ttll8 C T 15: 88,915,580 A553T possibly damaging Het
Ubxn11 G T 4: 134,116,120 E171D possibly damaging Het
Other mutations in Iqsec2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0193:Iqsec2 UTSW X 152223403 missense probably benign 0.33
R0675:Iqsec2 UTSW X 152204124 missense possibly damaging 0.76
R1169:Iqsec2 UTSW X 152144731 missense probably benign 0.01
R1171:Iqsec2 UTSW X 152144731 missense probably benign 0.01
R4397:Iqsec2 UTSW X 152209053 missense probably damaging 0.98
R4553:Iqsec2 UTSW X 152211281 missense probably benign 0.03
X0026:Iqsec2 UTSW X 152209650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGGGCCTATGTCTGAGG -3'
(R):5'- TCAGCCTCATACACCAGCTG -3'

Sequencing Primer
(F):5'- CTATGTCTGAGGAGCCAGGGTC -3'
(R):5'- TCATACACCAGCTGGCGGTG -3'
Posted On2015-07-06