Incidental Mutation 'R4396:Treml2'
ID 325514
Institutional Source Beutler Lab
Gene Symbol Treml2
Ensembl Gene ENSMUSG00000071068
Gene Name triggering receptor expressed on myeloid cells-like 2
Synonyms LOC328833
MMRRC Submission 041129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R4396 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 48300038-48312534 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48308114 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 209 (V209A)
Ref Sequence ENSEMBL: ENSMUSP00000128215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170941]
AlphaFold Q2LA85
Predicted Effect probably benign
Transcript: ENSMUST00000170941
AA Change: V209A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128215
Gene: ENSMUSG00000071068
AA Change: V209A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 129 3.13e-5 SMART
low complexity region 181 199 N/A INTRINSIC
transmembrane domain 268 290 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TREML2 is located in a gene cluster on chromosome 6 with the single Ig variable (IgV) domain activating receptors TREM1 (MIM 605085) and TREM2 (MIM 605086), but it has distinct structural and functional properties (Allcock et al., 2003 [PubMed 12645956]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Actn2 A G 13: 12,310,879 L70P probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gemin5 T A 11: 58,139,549 T817S probably benign Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kcnj4 C A 15: 79,484,673 A369S probably benign Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mtus2 T A 5: 148,203,938 N871K possibly damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxnb1 T C 9: 109,100,223 V49A possibly damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Rreb1 C T 13: 37,930,443 Q593* probably null Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Sirt1 T C 10: 63,321,998 T546A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf5 A T 1: 191,997,845 V415E probably benign Het
Traip C G 9: 107,959,487 T110S probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zswim1 A G 2: 164,825,449 D207G probably damaging Het
Other mutations in Treml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Treml2 APN 17 48302810 missense probably benign
IGL02797:Treml2 APN 17 48302711 missense possibly damaging 0.73
Cottonwood UTSW 17 48302747 missense possibly damaging 0.89
poplar UTSW 17 48302734 nonsense probably null
R0105:Treml2 UTSW 17 48302828 missense probably damaging 0.99
R0105:Treml2 UTSW 17 48302828 missense probably damaging 0.99
R0670:Treml2 UTSW 17 48307836 splice site probably null
R1538:Treml2 UTSW 17 48302758 missense possibly damaging 0.77
R1796:Treml2 UTSW 17 48309502 makesense probably null
R4679:Treml2 UTSW 17 48308175 missense probably benign 0.36
R4687:Treml2 UTSW 17 48309397 splice site probably null
R4801:Treml2 UTSW 17 48309159 missense probably benign 0.18
R4802:Treml2 UTSW 17 48309159 missense probably benign 0.18
R5314:Treml2 UTSW 17 48300573 missense probably damaging 0.99
R6791:Treml2 UTSW 17 48309219 missense probably benign 0.24
R6818:Treml2 UTSW 17 48302897 missense probably damaging 1.00
R6958:Treml2 UTSW 17 48308152 missense probably damaging 1.00
R7250:Treml2 UTSW 17 48309127 missense probably benign 0.05
R7535:Treml2 UTSW 17 48302819 missense probably damaging 1.00
R7850:Treml2 UTSW 17 48308140 missense probably benign 0.01
R8049:Treml2 UTSW 17 48302734 nonsense probably null
R8998:Treml2 UTSW 17 48302747 missense possibly damaging 0.89
R9012:Treml2 UTSW 17 48308062 missense possibly damaging 0.86
R9208:Treml2 UTSW 17 48307894 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGCCCTCACAACTGAGAG -3'
(R):5'- GGCCATGCCTGATAAAATATCAC -3'

Sequencing Primer
(F):5'- CATGGATGGATTTGTCACGACC -3'
(R):5'- TCACATAACCTGTTGGGAGTTAACGG -3'
Posted On 2015-07-06