Incidental Mutation 'R4397:H13'
ID325525
Institutional Source Beutler Lab
Gene Symbol H13
Ensembl Gene ENSMUSG00000019188
Gene Namehistocompatibility 13
SynonymsSpp, 1200006O09Rik, H-13, 5031424B04Rik, 4930443L17Rik
MMRRC Submission 041685-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4397 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152669461-152708670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152677552 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 65 (D65G)
Ref Sequence ENSEMBL: ENSMUSP00000105450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079247] [ENSMUST00000089059] [ENSMUST00000109825] [ENSMUST00000125366]
Predicted Effect probably benign
Transcript: ENSMUST00000079247
AA Change: D65G

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078236
Gene: ENSMUSG00000019188
AA Change: D65G

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
PSN 66 295 1.74e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089059
AA Change: D65G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000086460
Gene: ENSMUSG00000019188
AA Change: D65G

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
PSN 66 337 1.56e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109825
AA Change: D65G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105450
Gene: ENSMUSG00000019188
AA Change: D65G

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:Peptidase_A22B 62 174 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125366
AA Change: D65G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120068
Gene: ENSMUSG00000019188
AA Change: D65G

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
PSN 66 337 1.56e-119 SMART
low complexity region 355 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148156
Meta Mutation Damage Score 0.0786 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, which localizes to the endoplasmic reticulum, catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein. This activity is required to generate signal sequence-derived human lymphocyte antigen-E epitopes that are recognized by the immune system, and to process hepatitis C virus core protein. The encoded protein is an integral membrane protein with sequence motifs characteristic of the presenilin-type aspartic proteases. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: This is one of several loci identified by development of congenic strains differing in resistance to transplantable tumors. C57BL/10 carries the a allele and B10.129(14M) carries the b allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Agap2 G A 10: 127,090,483 A866T unknown Het
Aig1 A C 10: 13,652,982 S237A probably benign Het
Baz1b C T 5: 135,244,446 R1475W probably damaging Het
Bmp1 C T 14: 70,490,542 probably null Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dnajc15 T C 14: 77,874,794 probably null Het
Fam135b T A 15: 71,448,676 H1334L probably benign Het
Fancg A T 4: 43,008,897 H113Q probably benign Het
Gfap G A 11: 102,896,984 A45V probably benign Het
Gjd3 A T 11: 98,982,421 L199Q probably damaging Het
Gm8979 A G 7: 106,082,923 noncoding transcript Het
Hcls1 T C 16: 36,937,300 V5A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Iqgap3 T C 3: 88,104,358 Y817H probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Klb A G 5: 65,380,039 Y904C probably damaging Het
Kremen1 A T 11: 5,199,610 S354T probably benign Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lrp4 T C 2: 91,511,670 V1876A probably benign Het
Magi3 T C 3: 104,219,714 T85A probably damaging Het
Map3k12 C T 15: 102,501,259 A694T probably benign Het
Mex3b T C 7: 82,869,823 S449P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 96,973,564 probably null Het
Nlrp1a T G 11: 71,097,204 M1046L probably benign Het
Nphs1 T G 7: 30,481,965 probably null Het
Nup133 G A 8: 123,944,301 T119M probably benign Het
Olfr770 G T 10: 129,133,581 N62K possibly damaging Het
Pcdhga9 A T 18: 37,738,641 I508F probably damaging Het
Phactr3 A G 2: 178,175,406 probably benign Het
Plcb3 T C 19: 6,965,825 K155E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psg16 T C 7: 17,090,698 S45P possibly damaging Het
Ptpn21 G T 12: 98,688,248 P820Q probably damaging Het
Ptpn21 A G 12: 98,715,060 V105A probably damaging Het
Rnf7 A G 9: 96,478,410 M58T probably benign Het
Slc25a11 G A 11: 70,644,851 A287V probably benign Het
Slit2 G T 5: 48,220,081 probably null Het
Suco A G 1: 161,844,852 Y460H probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpv6 A G 6: 41,625,238 I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Virma A G 4: 11,513,901 E585G possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vmn2r88 A T 14: 51,417,978 D549V probably damaging Het
Other mutations in H13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02526:H13 APN 2 152688682 missense probably damaging 0.98
R0100:H13 UTSW 2 152689863 splice site probably null
R0100:H13 UTSW 2 152689863 splice site probably null
R0106:H13 UTSW 2 152686256 missense probably benign 0.09
R0178:H13 UTSW 2 152681067 missense probably damaging 1.00
R2880:H13 UTSW 2 152695561 missense probably damaging 1.00
R4058:H13 UTSW 2 152691874 missense probably damaging 1.00
R4110:H13 UTSW 2 152681109 missense probably damaging 0.99
R5698:H13 UTSW 2 152688955 missense probably damaging 1.00
R7145:H13 UTSW 2 152681072 missense probably damaging 1.00
R7773:H13 UTSW 2 152695511 missense probably damaging 1.00
R8116:H13 UTSW 2 152695526 missense probably damaging 1.00
R8192:H13 UTSW 2 152669602 missense probably benign
R8362:H13 UTSW 2 152686391 missense unknown
R8409:H13 UTSW 2 152689893 missense possibly damaging 0.94
RF005:H13 UTSW 2 152669669 missense probably damaging 1.00
RF008:H13 UTSW 2 152669669 missense probably damaging 1.00
RF016:H13 UTSW 2 152669669 missense probably damaging 1.00
RF019:H13 UTSW 2 152669669 missense probably damaging 1.00
RF023:H13 UTSW 2 152669669 missense probably damaging 1.00
RF024:H13 UTSW 2 152669669 missense probably damaging 1.00
X0019:H13 UTSW 2 152681070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTTGGCATCCCCTGTG -3'
(R):5'- GGTACAAGAACACAAGCCCTGG -3'

Sequencing Primer
(F):5'- CTTGGCATCCCCTGTGGTAGAG -3'
(R):5'- ACACAAGCCCTGGGAGACG -3'
Posted On2015-07-06