Mutagenetix > Incidental Mutation

Incidental Mutation 'R4397:H13'

325525

Institutional Source

Beutler Lab

Gene Symbol

H13

Ensembl Gene

ENSMUSG00000019188

Gene Name

histocompatibility 13

Synonyms

Spp, 1200006O09Rik, H-13, 5031424B04Rik, 4930443L17Rik

MMRRC Submission

041685-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4397 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

152669461-152708670 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 152677552 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 65 (D65G)

Ref Sequence

ENSEMBL: ENSMUSP00000105450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079247] [ENSMUST00000089059] [ENSMUST00000109825] [ENSMUST00000125366]

AlphaFold

Q9D8V0

Predicted Effect

probably benign
Transcript: ENSMUST00000079247
AA Change: D65G

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000078236
Gene: ENSMUSG00000019188
AA Change: D65G

Domain	Start	End	E-Value	Type
transmembrane domain	33	55	N/A	INTRINSIC
PSN	66	295	1.74e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000089059
AA Change: D65G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000086460
Gene: ENSMUSG00000019188
AA Change: D65G

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
PSN	66	337	1.56e-119	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109825
AA Change: D65G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105450
Gene: ENSMUSG00000019188
AA Change: D65G

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
Pfam:Peptidase_A22B	62	174	3.6e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125366
AA Change: D65G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000120068
Gene: ENSMUSG00000019188
AA Change: D65G

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
PSN	66	337	1.56e-119	SMART
low complexity region	355	371	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148156

Meta Mutation Damage Score

0.0786

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, which localizes to the endoplasmic reticulum, catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein. This activity is required to generate signal sequence-derived human lymphocyte antigen-E epitopes that are recognized by the immune system, and to process hepatitis C virus core protein. The encoded protein is an integral membrane protein with sequence motifs characteristic of the presenilin-type aspartic proteases. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: This is one of several loci identified by development of congenic strains differing in resistance to transplantable tumors. C57BL/10 carries the a allele and B10.129(14M) carries the b allele. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg4	T	G	X: 56,932,343	L2193V	probably damaging	Het
Agap2	G	A	10: 127,090,483	A866T	unknown	Het
Aig1	A	C	10: 13,652,982	S237A	probably benign	Het
Baz1b	C	T	5: 135,244,446	R1475W	probably damaging	Het
Bmp1	C	T	14: 70,490,542		probably null	Het
Crybg3	A	G	16: 59,560,095		probably benign	Het
Dnajc15	T	C	14: 77,874,794		probably null	Het
Fam135b	T	A	15: 71,448,676	H1334L	probably benign	Het
Fancg	A	T	4: 43,008,897	H113Q	probably benign	Het
Gfap	G	A	11: 102,896,984	A45V	probably benign	Het
Gjd3	A	T	11: 98,982,421	L199Q	probably damaging	Het
Gm8979	A	G	7: 106,082,923		noncoding transcript	Het
Hcls1	T	C	16: 36,937,300	V5A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Iqgap3	T	C	3: 88,104,358	Y817H	probably damaging	Het
Iqsec2	C	T	X: 152,209,053	T562I	probably damaging	Het
Klb	A	G	5: 65,380,039	Y904C	probably damaging	Het
Kremen1	A	T	11: 5,199,610	S354T	probably benign	Het
Lamc3	A	G	2: 31,931,952	E1304G	probably benign	Het
Lrp4	T	C	2: 91,511,670	V1876A	probably benign	Het
Magi3	T	C	3: 104,219,714	T85A	probably damaging	Het
Map3k12	C	T	15: 102,501,259	A694T	probably benign	Het
Mex3b	T	C	7: 82,869,823	S449P	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nars2	T	C	7: 96,973,564		probably null	Het
Nlrp1a	T	G	11: 71,097,204	M1046L	probably benign	Het
Nphs1	T	G	7: 30,481,965		probably null	Het
Nup133	G	A	8: 123,944,301	T119M	probably benign	Het
Olfr770	G	T	10: 129,133,581	N62K	possibly damaging	Het
Pcdhga9	A	T	18: 37,738,641	I508F	probably damaging	Het
Phactr3	A	G	2: 178,175,406		probably benign	Het
Plcb3	T	C	19: 6,965,825	K155E	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Prss38	T	C	11: 59,373,028	Y286C	probably damaging	Het
Psg16	T	C	7: 17,090,698	S45P	possibly damaging	Het
Ptpn21	G	T	12: 98,688,248	P820Q	probably damaging	Het
Ptpn21	A	G	12: 98,715,060	V105A	probably damaging	Het
Rnf7	A	G	9: 96,478,410	M58T	probably benign	Het
Slc25a11	G	A	11: 70,644,851	A287V	probably benign	Het
Slit2	G	T	5: 48,220,081		probably null	Het
Suco	A	G	1: 161,844,852	Y460H	probably damaging	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Trpv6	A	G	6: 41,625,238	I379T	possibly damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Virma	A	G	4: 11,513,901	E585G	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Vmn2r88	A	T	14: 51,417,978	D549V	probably damaging	Het

Other mutations in H13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02526:H13	APN	2	152688682	missense	probably damaging	0.98
R0100:H13	UTSW	2	152689863	splice site	probably null
R0100:H13	UTSW	2	152689863	splice site	probably null
R0106:H13	UTSW	2	152686256	missense	probably benign	0.09
R0178:H13	UTSW	2	152681067	missense	probably damaging	1.00
R2880:H13	UTSW	2	152695561	missense	probably damaging	1.00
R4058:H13	UTSW	2	152691874	missense	probably damaging	1.00
R4110:H13	UTSW	2	152681109	missense	probably damaging	0.99
R5698:H13	UTSW	2	152688955	missense	probably damaging	1.00
R7145:H13	UTSW	2	152681072	missense	probably damaging	1.00
R7773:H13	UTSW	2	152695511	missense	probably damaging	1.00
R8116:H13	UTSW	2	152695526	missense	probably damaging	1.00
R8192:H13	UTSW	2	152669602	missense	probably benign
R8362:H13	UTSW	2	152686391	missense	unknown
R8409:H13	UTSW	2	152689893	missense	possibly damaging	0.94
R8891:H13	UTSW	2	152704129	missense	probably benign
R9153:H13	UTSW	2	152691868	missense	possibly damaging	0.47
R9258:H13	UTSW	2	152681079	missense	probably damaging	1.00
R9385:H13	UTSW	2	152695493	missense	probably benign	0.25
R9617:H13	UTSW	2	152688953	missense	probably damaging	1.00
RF005:H13	UTSW	2	152669669	missense	probably damaging	1.00
RF008:H13	UTSW	2	152669669	missense	probably damaging	1.00
RF016:H13	UTSW	2	152669669	missense	probably damaging	1.00
RF019:H13	UTSW	2	152669669	missense	probably damaging	1.00
RF023:H13	UTSW	2	152669669	missense	probably damaging	1.00
RF024:H13	UTSW	2	152669669	missense	probably damaging	1.00
X0019:H13	UTSW	2	152681070	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATCTTGGCATCCCCTGTG -3'
(R):5'- GGTACAAGAACACAAGCCCTGG -3'

Sequencing Primer
(F):5'- CTTGGCATCCCCTGTGGTAGAG -3'
(R):5'- ACACAAGCCCTGGGAGACG -3'

Posted On

2015-07-06