Incidental Mutation 'R4397:Virma'
ID325529
Institutional Source Beutler Lab
Gene Symbol Virma
Ensembl Gene ENSMUSG00000040720
Gene Namevir like m6A methyltransferase associated
Synonyms1110037F02Rik
MMRRC Submission 041685-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4397 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location11485958-11550684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11513901 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 585 (E585G)
Ref Sequence ENSEMBL: ENSMUSP00000103943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055372] [ENSMUST00000059914] [ENSMUST00000108307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055372
AA Change: E585G

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000063188
Gene: ENSMUSG00000040720
AA Change: E585G

DomainStartEndE-ValueType
low complexity region 139 153 N/A INTRINSIC
low complexity region 172 198 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000059914
AA Change: E585G

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058078
Gene: ENSMUSG00000040720
AA Change: E585G

DomainStartEndE-ValueType
low complexity region 139 153 N/A INTRINSIC
low complexity region 172 198 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1224 1232 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
low complexity region 1460 1474 N/A INTRINSIC
low complexity region 1618 1634 N/A INTRINSIC
low complexity region 1684 1697 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
low complexity region 1796 1808 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108307
AA Change: E585G

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103943
Gene: ENSMUSG00000040720
AA Change: E585G

DomainStartEndE-ValueType
Pfam:VIR_N 5 266 2e-110 PFAM
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1058 1070 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1274 1282 N/A INTRINSIC
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1510 1524 N/A INTRINSIC
low complexity region 1668 1684 N/A INTRINSIC
low complexity region 1734 1747 N/A INTRINSIC
low complexity region 1800 1807 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Agap2 G A 10: 127,090,483 A866T unknown Het
Aig1 A C 10: 13,652,982 S237A probably benign Het
Baz1b C T 5: 135,244,446 R1475W probably damaging Het
Bmp1 C T 14: 70,490,542 probably null Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dnajc15 T C 14: 77,874,794 probably null Het
Fam135b T A 15: 71,448,676 H1334L probably benign Het
Fancg A T 4: 43,008,897 H113Q probably benign Het
Gfap G A 11: 102,896,984 A45V probably benign Het
Gjd3 A T 11: 98,982,421 L199Q probably damaging Het
Gm8979 A G 7: 106,082,923 noncoding transcript Het
H13 A G 2: 152,677,552 D65G probably damaging Het
Hcls1 T C 16: 36,937,300 V5A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Iqgap3 T C 3: 88,104,358 Y817H probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Klb A G 5: 65,380,039 Y904C probably damaging Het
Kremen1 A T 11: 5,199,610 S354T probably benign Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lrp4 T C 2: 91,511,670 V1876A probably benign Het
Magi3 T C 3: 104,219,714 T85A probably damaging Het
Map3k12 C T 15: 102,501,259 A694T probably benign Het
Mex3b T C 7: 82,869,823 S449P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 96,973,564 probably null Het
Nlrp1a T G 11: 71,097,204 M1046L probably benign Het
Nphs1 T G 7: 30,481,965 probably null Het
Nup133 G A 8: 123,944,301 T119M probably benign Het
Olfr770 G T 10: 129,133,581 N62K possibly damaging Het
Pcdhga9 A T 18: 37,738,641 I508F probably damaging Het
Phactr3 A G 2: 178,175,406 probably benign Het
Plcb3 T C 19: 6,965,825 K155E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psg16 T C 7: 17,090,698 S45P possibly damaging Het
Ptpn21 G T 12: 98,688,248 P820Q probably damaging Het
Ptpn21 A G 12: 98,715,060 V105A probably damaging Het
Rnf7 A G 9: 96,478,410 M58T probably benign Het
Slc25a11 G A 11: 70,644,851 A287V probably benign Het
Slit2 G T 5: 48,220,081 probably null Het
Suco A G 1: 161,844,852 Y460H probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpv6 A G 6: 41,625,238 I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vmn2r88 A T 14: 51,417,978 D549V probably damaging Het
Other mutations in Virma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Virma APN 4 11519424 splice site probably benign
IGL00477:Virma APN 4 11519006 missense probably damaging 0.99
IGL01293:Virma APN 4 11521114 missense probably damaging 1.00
IGL01410:Virma APN 4 11518929 nonsense probably null
IGL01531:Virma APN 4 11528753 missense probably damaging 1.00
IGL01672:Virma APN 4 11527792 missense probably damaging 1.00
IGL01724:Virma APN 4 11528672 missense probably damaging 1.00
IGL01747:Virma APN 4 11526877 missense probably damaging 1.00
IGL01776:Virma APN 4 11527792 missense probably damaging 1.00
IGL02064:Virma APN 4 11513163 missense possibly damaging 0.87
IGL02243:Virma APN 4 11546031 missense probably damaging 1.00
IGL02244:Virma APN 4 11546031 missense probably damaging 1.00
IGL02445:Virma APN 4 11527029 missense probably damaging 0.97
IGL02546:Virma APN 4 11494804 missense probably damaging 0.99
IGL02807:Virma APN 4 11507079 splice site probably benign
IGL02967:Virma APN 4 11514096 missense probably benign 0.01
IGL03211:Virma APN 4 11548770 nonsense probably null
IGL03242:Virma APN 4 11527669 missense possibly damaging 0.70
IGL03256:Virma APN 4 11542207 splice site probably benign
IGL03327:Virma APN 4 11518984 missense probably benign 0.00
IGL03346:Virma APN 4 11518984 missense probably benign 0.00
PIT4802001:Virma UTSW 4 11546008 missense probably damaging 0.99
R0142:Virma UTSW 4 11548783 missense probably benign 0.04
R0355:Virma UTSW 4 11528626 nonsense probably null
R0522:Virma UTSW 4 11519416 critical splice donor site probably null
R0600:Virma UTSW 4 11498769 missense probably damaging 0.99
R1435:Virma UTSW 4 11528621 missense probably damaging 1.00
R1489:Virma UTSW 4 11521164 missense probably damaging 1.00
R1568:Virma UTSW 4 11528776 missense probably damaging 0.99
R1616:Virma UTSW 4 11544954 missense probably damaging 1.00
R1655:Virma UTSW 4 11494786 missense probably damaging 1.00
R1695:Virma UTSW 4 11494814 missense probably damaging 0.98
R1835:Virma UTSW 4 11540511 missense probably benign 0.02
R1951:Virma UTSW 4 11513907 missense probably benign 0.00
R1991:Virma UTSW 4 11519242 missense probably benign 0.06
R2145:Virma UTSW 4 11548726 splice site probably benign
R2172:Virma UTSW 4 11527843 missense possibly damaging 0.82
R2217:Virma UTSW 4 11544924 missense probably damaging 1.00
R2218:Virma UTSW 4 11544924 missense probably damaging 1.00
R2248:Virma UTSW 4 11518927 missense probably damaging 1.00
R2342:Virma UTSW 4 11501316 missense probably damaging 1.00
R3424:Virma UTSW 4 11513177 nonsense probably null
R4449:Virma UTSW 4 11498828 critical splice donor site probably null
R4660:Virma UTSW 4 11513505 missense probably damaging 1.00
R4698:Virma UTSW 4 11528636 missense probably damaging 0.99
R4878:Virma UTSW 4 11544971 missense probably damaging 1.00
R4937:Virma UTSW 4 11521147 nonsense probably null
R5031:Virma UTSW 4 11542116 nonsense probably null
R5040:Virma UTSW 4 11528746 missense probably benign 0.01
R5061:Virma UTSW 4 11494840 missense possibly damaging 0.95
R5091:Virma UTSW 4 11519392 missense probably benign 0.00
R5137:Virma UTSW 4 11546297 missense probably damaging 1.00
R5262:Virma UTSW 4 11539926 missense probably benign 0.01
R5297:Virma UTSW 4 11494819 missense probably damaging 1.00
R5730:Virma UTSW 4 11542154 missense probably benign 0.44
R5818:Virma UTSW 4 11513319 missense possibly damaging 0.92
R5835:Virma UTSW 4 11514036 missense probably damaging 1.00
R6125:Virma UTSW 4 11521172 missense probably damaging 0.98
R6197:Virma UTSW 4 11505498 missense probably damaging 0.96
R6222:Virma UTSW 4 11527820 missense probably damaging 1.00
R6793:Virma UTSW 4 11539968 missense probably damaging 1.00
R7028:Virma UTSW 4 11519249 missense possibly damaging 0.50
R7356:Virma UTSW 4 11513595 missense probably damaging 0.99
R7383:Virma UTSW 4 11514026 missense probably damaging 0.98
R7391:Virma UTSW 4 11508099 missense probably damaging 0.99
R7425:Virma UTSW 4 11546211 missense possibly damaging 0.95
R7556:Virma UTSW 4 11518927 missense probably damaging 1.00
R7715:Virma UTSW 4 11549682 missense probably damaging 1.00
R7715:Virma UTSW 4 11513016 splice site probably null
R7986:Virma UTSW 4 11540023 missense probably benign 0.01
R7990:Virma UTSW 4 11513983 missense probably benign 0.00
R8048:Virma UTSW 4 11539918 nonsense probably null
R8050:Virma UTSW 4 11528643 missense probably benign 0.22
R8412:Virma UTSW 4 11521261 critical splice donor site probably null
R8544:Virma UTSW 4 11516949 missense probably benign
R8551:Virma UTSW 4 11513397 missense probably damaging 1.00
R8699:Virma UTSW 4 11528678 missense probably benign 0.04
R8739:Virma UTSW 4 11540643 critical splice donor site probably null
R8950:Virma UTSW 4 11519047 nonsense probably null
X0020:Virma UTSW 4 11486055 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTTGGACAGTGTCATTAGC -3'
(R):5'- AGGTGCAGTTTCCATGACATG -3'

Sequencing Primer
(F):5'- CCCAAAATGAGAAAAGTGGCTATC -3'
(R):5'- GGTGCAGTTTCCATGACATGAAAAAC -3'
Posted On2015-07-06