Mutagenetix > Incidental Mutation

Incidental Mutation 'R4397:Fancg'

325530

Institutional Source

Beutler Lab

Gene Symbol

Fancg

Ensembl Gene

ENSMUSG00000028453

Gene Name

Fanconi anemia, complementation group G

Synonyms

Xrcc9

MMRRC Submission

041685-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.513) question?

Stock #

R4397 (G1)

Quality Score

187

Status

Validated

Chromosome

Chromosomal Location

43002343-43010506 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43008897 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 113 (H113Q)

Ref Sequence

ENSEMBL: ENSMUSP00000030165 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030165]

AlphaFold

Q9EQR6

Predicted Effect

probably benign
Transcript: ENSMUST00000030165
AA Change: H113Q

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000030165
Gene: ENSMUSG00000028453
AA Change: H113Q

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
low complexity region	131	144	N/A	INTRINSIC
low complexity region	164	179	N/A	INTRINSIC
low complexity region	190	199	N/A	INTRINSIC
Pfam:TPR_1	251	280	4.1e-6	PFAM
Pfam:TPR_2	251	281	7.3e-5	PFAM
Pfam:TPR_8	251	281	4.5e-3	PFAM
low complexity region	302	317	N/A	INTRINSIC
low complexity region	401	418	N/A	INTRINSIC
Blast:TPR	458	491	4e-9	BLAST
Blast:TPR	518	550	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124645

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125570

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127067

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133915

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134083

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135362

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148018

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group G. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females and males homozygous for targeted null mutations exhibit hypogonadism and reduced fertility. Cytogeneic analysis showed somatic chromosome aberrations occur at a higher spontaneous rate and are easier to induce than in normal cells. Cells are also more sensitive to mitomycin C. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg4	T	G	X: 56,932,343	L2193V	probably damaging	Het
Agap2	G	A	10: 127,090,483	A866T	unknown	Het
Aig1	A	C	10: 13,652,982	S237A	probably benign	Het
Baz1b	C	T	5: 135,244,446	R1475W	probably damaging	Het
Bmp1	C	T	14: 70,490,542		probably null	Het
Crybg3	A	G	16: 59,560,095		probably benign	Het
Dnajc15	T	C	14: 77,874,794		probably null	Het
Fam135b	T	A	15: 71,448,676	H1334L	probably benign	Het
Gfap	G	A	11: 102,896,984	A45V	probably benign	Het
Gjd3	A	T	11: 98,982,421	L199Q	probably damaging	Het
Gm8979	A	G	7: 106,082,923		noncoding transcript	Het
H13	A	G	2: 152,677,552	D65G	probably damaging	Het
Hcls1	T	C	16: 36,937,300	V5A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Iqgap3	T	C	3: 88,104,358	Y817H	probably damaging	Het
Iqsec2	C	T	X: 152,209,053	T562I	probably damaging	Het
Klb	A	G	5: 65,380,039	Y904C	probably damaging	Het
Kremen1	A	T	11: 5,199,610	S354T	probably benign	Het
Lamc3	A	G	2: 31,931,952	E1304G	probably benign	Het
Lrp4	T	C	2: 91,511,670	V1876A	probably benign	Het
Magi3	T	C	3: 104,219,714	T85A	probably damaging	Het
Map3k12	C	T	15: 102,501,259	A694T	probably benign	Het
Mex3b	T	C	7: 82,869,823	S449P	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nars2	T	C	7: 96,973,564		probably null	Het
Nlrp1a	T	G	11: 71,097,204	M1046L	probably benign	Het
Nphs1	T	G	7: 30,481,965		probably null	Het
Nup133	G	A	8: 123,944,301	T119M	probably benign	Het
Olfr770	G	T	10: 129,133,581	N62K	possibly damaging	Het
Pcdhga9	A	T	18: 37,738,641	I508F	probably damaging	Het
Phactr3	A	G	2: 178,175,406		probably benign	Het
Plcb3	T	C	19: 6,965,825	K155E	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Prss38	T	C	11: 59,373,028	Y286C	probably damaging	Het
Psg16	T	C	7: 17,090,698	S45P	possibly damaging	Het
Ptpn21	G	T	12: 98,688,248	P820Q	probably damaging	Het
Ptpn21	A	G	12: 98,715,060	V105A	probably damaging	Het
Rnf7	A	G	9: 96,478,410	M58T	probably benign	Het
Slc25a11	G	A	11: 70,644,851	A287V	probably benign	Het
Slit2	G	T	5: 48,220,081		probably null	Het
Suco	A	G	1: 161,844,852	Y460H	probably damaging	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Trpv6	A	G	6: 41,625,238	I379T	possibly damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Virma	A	G	4: 11,513,901	E585G	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Vmn2r88	A	T	14: 51,417,978	D549V	probably damaging	Het

Other mutations in Fancg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Fancg	APN	4	43003910	nonsense	probably null
IGL02072:Fancg	APN	4	43007062	missense	probably benign	0.00
IGL02184:Fancg	APN	4	43006872	missense	possibly damaging	0.79
IGL02989:Fancg	APN	4	43007121	splice site	probably benign
R0671:Fancg	UTSW	4	43002998	missense	probably benign	0.00
R1581:Fancg	UTSW	4	43007039	missense	probably damaging	1.00
R1853:Fancg	UTSW	4	43009727	missense	probably benign	0.00
R2046:Fancg	UTSW	4	43004604	missense	probably damaging	1.00
R2519:Fancg	UTSW	4	43008787	missense	probably damaging	1.00
R4282:Fancg	UTSW	4	43003830	missense	probably damaging	1.00
R4583:Fancg	UTSW	4	43002991	missense	probably benign
R4671:Fancg	UTSW	4	43005272	missense	probably benign	0.01
R4887:Fancg	UTSW	4	43006866	missense	probably benign	0.18
R5309:Fancg	UTSW	4	43003019	missense	probably benign	0.23
R5312:Fancg	UTSW	4	43003019	missense	probably benign	0.23
R5325:Fancg	UTSW	4	43006564	missense	probably damaging	0.99
R5379:Fancg	UTSW	4	43002998	missense	probably benign	0.00
R5386:Fancg	UTSW	4	43007076	nonsense	probably null
R5649:Fancg	UTSW	4	43008736	missense	probably damaging	1.00
R5788:Fancg	UTSW	4	43007130	intron	probably benign
R5802:Fancg	UTSW	4	43006582	missense	probably benign
R6217:Fancg	UTSW	4	43010084	missense	probably benign	0.03
R6698:Fancg	UTSW	4	43007034	missense	probably benign	0.00
R7092:Fancg	UTSW	4	43004831	missense	probably benign	0.03
R7527:Fancg	UTSW	4	43010116	start gained	probably benign
R7664:Fancg	UTSW	4	43010066	missense	probably benign	0.01
R7979:Fancg	UTSW	4	43004963	missense	probably damaging	1.00
R8129:Fancg	UTSW	4	43005036	splice site	probably null
R8473:Fancg	UTSW	4	43004963	missense	probably damaging	1.00
R8885:Fancg	UTSW	4	43007266	critical splice donor site	probably null
R9166:Fancg	UTSW	4	43006800	missense	probably benign	0.04
R9243:Fancg	UTSW	4	43006565	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- GTGGGGAGGTACATTCATCTTC -3'
(R):5'- AGGAACATCTGTCCACGGAG -3'

Sequencing Primer
(F):5'- CAGTTACCTGGCTGCCATTTAGG -3'
(R):5'- ATCTGTCCACGGAGACAGATGTTC -3'

Posted On

2015-07-06