Mutagenetix > Incidental Mutation

Incidental Mutation 'R4397:Klb'

325532

Institutional Source

Beutler Lab

Gene Symbol

Klb

Ensembl Gene

ENSMUSG00000029195

Gene Name

klotho beta

Synonyms

betaKlotho

MMRRC Submission

041685-MU

Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Is this an essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R4397 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65348314-65384007 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65380039 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 904 (Y904C)

Ref Sequence

ENSEMBL: ENSMUSP00000031096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000205084]

AlphaFold

Q99N32

Predicted Effect

probably damaging
Transcript: ENSMUST00000031096
AA Change: Y904C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: Y904C

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	77	385	8.8e-96	PFAM
Pfam:Glyco_hydro_1	374	506	1.7e-31	PFAM
Pfam:Glyco_hydro_1	515	965	6.3e-80	PFAM
transmembrane domain	995	1017	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205084

SMART Domains

Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	77	360	8.6e-94	PFAM

Meta Mutation Damage Score

0.7233

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

96% (55/57)

MGI Phenotype

Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg4	T	G	X: 56,932,343	L2193V	probably damaging	Het
Agap2	G	A	10: 127,090,483	A866T	unknown	Het
Aig1	A	C	10: 13,652,982	S237A	probably benign	Het
Baz1b	C	T	5: 135,244,446	R1475W	probably damaging	Het
Bmp1	C	T	14: 70,490,542		probably null	Het
Crybg3	A	G	16: 59,560,095		probably benign	Het
Dnajc15	T	C	14: 77,874,794		probably null	Het
Fam135b	T	A	15: 71,448,676	H1334L	probably benign	Het
Fancg	A	T	4: 43,008,897	H113Q	probably benign	Het
Gfap	G	A	11: 102,896,984	A45V	probably benign	Het
Gjd3	A	T	11: 98,982,421	L199Q	probably damaging	Het
Gm8979	A	G	7: 106,082,923		noncoding transcript	Het
H13	A	G	2: 152,677,552	D65G	probably damaging	Het
Hcls1	T	C	16: 36,937,300	V5A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Iqgap3	T	C	3: 88,104,358	Y817H	probably damaging	Het
Iqsec2	C	T	X: 152,209,053	T562I	probably damaging	Het
Kremen1	A	T	11: 5,199,610	S354T	probably benign	Het
Lamc3	A	G	2: 31,931,952	E1304G	probably benign	Het
Lrp4	T	C	2: 91,511,670	V1876A	probably benign	Het
Magi3	T	C	3: 104,219,714	T85A	probably damaging	Het
Map3k12	C	T	15: 102,501,259	A694T	probably benign	Het
Mex3b	T	C	7: 82,869,823	S449P	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nars2	T	C	7: 96,973,564		probably null	Het
Nlrp1a	T	G	11: 71,097,204	M1046L	probably benign	Het
Nphs1	T	G	7: 30,481,965		probably null	Het
Nup133	G	A	8: 123,944,301	T119M	probably benign	Het
Olfr770	G	T	10: 129,133,581	N62K	possibly damaging	Het
Pcdhga9	A	T	18: 37,738,641	I508F	probably damaging	Het
Phactr3	A	G	2: 178,175,406		probably benign	Het
Plcb3	T	C	19: 6,965,825	K155E	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Prss38	T	C	11: 59,373,028	Y286C	probably damaging	Het
Psg16	T	C	7: 17,090,698	S45P	possibly damaging	Het
Ptpn21	G	T	12: 98,688,248	P820Q	probably damaging	Het
Ptpn21	A	G	12: 98,715,060	V105A	probably damaging	Het
Rnf7	A	G	9: 96,478,410	M58T	probably benign	Het
Slc25a11	G	A	11: 70,644,851	A287V	probably benign	Het
Slit2	G	T	5: 48,220,081		probably null	Het
Suco	A	G	1: 161,844,852	Y460H	probably damaging	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Trpv6	A	G	6: 41,625,238	I379T	possibly damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Virma	A	G	4: 11,513,901	E585G	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Vmn2r88	A	T	14: 51,417,978	D549V	probably damaging	Het

Other mutations in Klb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Klb	APN	5	65372374	missense	possibly damaging	0.90
IGL00821:Klb	APN	5	65372149	missense	probably damaging	1.00
IGL01082:Klb	APN	5	65375940	missense	possibly damaging	0.71
IGL01637:Klb	APN	5	65375679	critical splice acceptor site	probably null
IGL02098:Klb	APN	5	65379885	missense	probably benign	0.21
IGL03113:Klb	APN	5	65383470	missense	probably benign	0.00
1mM(1):Klb	UTSW	5	65348650	missense	probably damaging	1.00
P0016:Klb	UTSW	5	65379923	nonsense	probably null
R0268:Klb	UTSW	5	65348837	missense	probably benign	0.02
R0383:Klb	UTSW	5	65372499	splice site	probably null
R0676:Klb	UTSW	5	65379055	missense	probably damaging	1.00
R0735:Klb	UTSW	5	65379727	missense	probably benign
R0972:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1051:Klb	UTSW	5	65379327	missense	probably damaging	1.00
R1168:Klb	UTSW	5	65378974	missense	probably damaging	1.00
R1372:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1403:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1403:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1446:Klb	UTSW	5	65348995	missense	probably damaging	1.00
R1696:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1743:Klb	UTSW	5	65375861	missense	probably damaging	0.99
R1801:Klb	UTSW	5	65349235	missense	probably null	0.90
R1804:Klb	UTSW	5	65379853	missense	probably damaging	1.00
R1848:Klb	UTSW	5	65348837	missense	probably benign	0.02
R1967:Klb	UTSW	5	65372074	missense	probably damaging	0.98
R3420:Klb	UTSW	5	65372142	missense	probably damaging	1.00
R4490:Klb	UTSW	5	65375794	missense	probably benign	0.02
R4491:Klb	UTSW	5	65375794	missense	probably benign	0.02
R4547:Klb	UTSW	5	65379928	missense	probably benign	0.00
R4878:Klb	UTSW	5	65348490	missense	probably damaging	0.99
R5269:Klb	UTSW	5	65348797	missense	probably damaging	1.00
R5418:Klb	UTSW	5	65383470	missense	probably benign	0.00
R5453:Klb	UTSW	5	65383385	missense	probably benign	0.08
R5541:Klb	UTSW	5	65379234	missense	probably benign	0.27
R5672:Klb	UTSW	5	65379949	missense	possibly damaging	0.82
R5841:Klb	UTSW	5	65379324	nonsense	probably null
R6088:Klb	UTSW	5	65349013	missense	probably benign	0.07
R6807:Klb	UTSW	5	65379534	missense	probably damaging	1.00
R6955:Klb	UTSW	5	65379088	nonsense	probably null
R7068:Klb	UTSW	5	65379340	missense	probably damaging	1.00
R7284:Klb	UTSW	5	65383478	missense	probably benign	0.01
R7322:Klb	UTSW	5	65383364	missense	probably benign	0.44
R7346:Klb	UTSW	5	65348631	nonsense	probably null
R7366:Klb	UTSW	5	65372431	missense	probably damaging	1.00
R8134:Klb	UTSW	5	65383615	missense	probably benign	0.00
R8243:Klb	UTSW	5	65378995	missense	possibly damaging	0.65
R8409:Klb	UTSW	5	65379535	missense	probably damaging	0.96
R8971:Klb	UTSW	5	65375683	missense	probably damaging	1.00
R9193:Klb	UTSW	5	65372025	missense	possibly damaging	0.63
R9305:Klb	UTSW	5	65348645	nonsense	probably null
R9390:Klb	UTSW	5	65375701	missense	possibly damaging	0.50
R9531:Klb	UTSW	5	65383605	missense
R9768:Klb	UTSW	5	65380030	missense	probably damaging	1.00
Z1177:Klb	UTSW	5	65348741	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCGCTCAGTTGCAGACAG -3'
(R):5'- AAATCTTCAGTCGGTGGTGAG -3'

Sequencing Primer
(F):5'- TCAGTTGCAGACAGGGACGTC -3'
(R):5'- TGTTTGTTGTTTCTCAGAAATCTGCC -3'

Posted On

2015-07-06