Incidental Mutation 'R4397:Baz1b'
ID 325533
Institutional Source Beutler Lab
Gene Symbol Baz1b
Ensembl Gene ENSMUSG00000002748
Gene Name bromodomain adjacent to zinc finger domain, 1B
Synonyms Wbscr9, WSTF
MMRRC Submission 041685-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4397 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 135216118-135274983 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 135273300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1475 (R1475W)
Ref Sequence ENSEMBL: ENSMUSP00000002825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002825] [ENSMUST00000062572]
AlphaFold Q9Z277
Predicted Effect probably damaging
Transcript: ENSMUST00000002825
AA Change: R1475W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002825
Gene: ENSMUSG00000002748
AA Change: R1475W

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 21 120 2.6e-28 PFAM
low complexity region 312 335 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
coiled coil region 537 587 N/A INTRINSIC
DDT 605 669 5.59e-17 SMART
Pfam:WHIM1 725 773 2.2e-9 PFAM
low complexity region 822 835 N/A INTRINSIC
coiled coil region 854 890 N/A INTRINSIC
Pfam:WHIM2 900 935 1.3e-10 PFAM
Pfam:WHIM3 991 1029 1.5e-16 PFAM
low complexity region 1131 1148 N/A INTRINSIC
PHD 1186 1232 1.89e-14 SMART
RING 1187 1231 7.85e-2 SMART
low complexity region 1245 1277 N/A INTRINSIC
BROMO 1333 1441 3.63e-37 SMART
low complexity region 1459 1472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062572
SMART Domains Protein: ENSMUSP00000053551
Gene: ENSMUSG00000049551

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FRI 39 158 1.97e-73 SMART
low complexity region 177 195 N/A INTRINSIC
Frizzled 222 548 4.64e-199 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136947
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bromodomain protein family. The bromodomain is a structural motif characteristic of proteins involved in chromatin-dependent regulation of transcription. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality by P2, small size at birth, impaired double strand DNA repair, and heart defects. Mice heterozygous for a null allele exhibit hypercalcemia and heart defects. Mice homozygous for an ENU mutation exhibit craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 55,977,703 (GRCm39) L2193V probably damaging Het
Agap2 G A 10: 126,926,352 (GRCm39) A866T unknown Het
Aig1 A C 10: 13,528,726 (GRCm39) S237A probably benign Het
Bmp1 C T 14: 70,727,982 (GRCm39) probably null Het
Crybg3 A G 16: 59,380,458 (GRCm39) probably benign Het
Dnajc15 T C 14: 78,112,234 (GRCm39) probably null Het
Fam135b T A 15: 71,320,525 (GRCm39) H1334L probably benign Het
Fancg A T 4: 43,008,897 (GRCm39) H113Q probably benign Het
Gfap G A 11: 102,787,810 (GRCm39) A45V probably benign Het
Gjd3 A T 11: 98,873,247 (GRCm39) L199Q probably damaging Het
Gvin-ps3 A G 7: 105,682,130 (GRCm39) noncoding transcript Het
H13 A G 2: 152,519,472 (GRCm39) D65G probably damaging Het
Hcls1 T C 16: 36,757,662 (GRCm39) V5A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Iqgap3 T C 3: 88,011,665 (GRCm39) Y817H probably damaging Het
Iqsec2 C T X: 150,992,049 (GRCm39) T562I probably damaging Het
Klb A G 5: 65,537,382 (GRCm39) Y904C probably damaging Het
Kremen1 A T 11: 5,149,610 (GRCm39) S354T probably benign Het
Lamc3 A G 2: 31,821,964 (GRCm39) E1304G probably benign Het
Lrp4 T C 2: 91,342,015 (GRCm39) V1876A probably benign Het
Magi3 T C 3: 104,127,030 (GRCm39) T85A probably damaging Het
Map3k12 C T 15: 102,409,694 (GRCm39) A694T probably benign Het
Mex3b T C 7: 82,519,031 (GRCm39) S449P possibly damaging Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nars2 T C 7: 96,622,771 (GRCm39) probably null Het
Nlrp1a T G 11: 70,988,030 (GRCm39) M1046L probably benign Het
Nphs1 T G 7: 30,181,390 (GRCm39) probably null Het
Nup133 G A 8: 124,671,040 (GRCm39) T119M probably benign Het
Or6c201 G T 10: 128,969,450 (GRCm39) N62K possibly damaging Het
Pcdhga9 A T 18: 37,871,694 (GRCm39) I508F probably damaging Het
Phactr3 A G 2: 177,817,199 (GRCm39) probably benign Het
Plcb3 T C 19: 6,943,193 (GRCm39) K155E probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Prss38 T C 11: 59,263,854 (GRCm39) Y286C probably damaging Het
Psg16 T C 7: 16,824,623 (GRCm39) S45P possibly damaging Het
Ptpn21 G T 12: 98,654,507 (GRCm39) P820Q probably damaging Het
Ptpn21 A G 12: 98,681,319 (GRCm39) V105A probably damaging Het
Rnf7 A G 9: 96,360,463 (GRCm39) M58T probably benign Het
Slc25a11 G A 11: 70,535,677 (GRCm39) A287V probably benign Het
Slit2 G T 5: 48,377,423 (GRCm39) probably null Het
Suco A G 1: 161,672,421 (GRCm39) Y460H probably damaging Het
Tnxb C T 17: 34,897,636 (GRCm39) Q804* probably null Het
Trpv6 A G 6: 41,602,172 (GRCm39) I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Virma A G 4: 11,513,901 (GRCm39) E585G possibly damaging Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Vmn2r88 A T 14: 51,655,435 (GRCm39) D549V probably damaging Het
Other mutations in Baz1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Baz1b APN 5 135,245,444 (GRCm39) missense probably damaging 0.99
IGL00589:Baz1b APN 5 135,225,346 (GRCm39) missense possibly damaging 0.50
IGL00736:Baz1b APN 5 135,268,886 (GRCm39) missense probably damaging 1.00
IGL02053:Baz1b APN 5 135,271,320 (GRCm39) missense probably benign 0.00
IGL02197:Baz1b APN 5 135,237,951 (GRCm39) missense probably benign 0.20
IGL02236:Baz1b APN 5 135,246,138 (GRCm39) missense probably damaging 1.00
IGL02351:Baz1b APN 5 135,273,160 (GRCm39) missense probably damaging 1.00
IGL02358:Baz1b APN 5 135,273,160 (GRCm39) missense probably damaging 1.00
IGL02424:Baz1b APN 5 135,246,833 (GRCm39) missense probably damaging 1.00
IGL03051:Baz1b APN 5 135,246,079 (GRCm39) missense probably benign 0.02
PIT4480001:Baz1b UTSW 5 135,246,819 (GRCm39) missense probably damaging 1.00
R0097:Baz1b UTSW 5 135,227,113 (GRCm39) missense probably benign 0.11
R0097:Baz1b UTSW 5 135,227,113 (GRCm39) missense probably benign 0.11
R0365:Baz1b UTSW 5 135,268,985 (GRCm39) missense probably benign 0.00
R0655:Baz1b UTSW 5 135,271,284 (GRCm39) missense probably benign 0.00
R0698:Baz1b UTSW 5 135,227,075 (GRCm39) missense probably damaging 1.00
R0959:Baz1b UTSW 5 135,273,076 (GRCm39) missense probably damaging 1.00
R1411:Baz1b UTSW 5 135,259,177 (GRCm39) missense possibly damaging 0.73
R1469:Baz1b UTSW 5 135,246,833 (GRCm39) missense probably damaging 1.00
R1469:Baz1b UTSW 5 135,246,833 (GRCm39) missense probably damaging 1.00
R1511:Baz1b UTSW 5 135,246,636 (GRCm39) missense probably damaging 1.00
R1557:Baz1b UTSW 5 135,247,097 (GRCm39) missense possibly damaging 0.94
R1674:Baz1b UTSW 5 135,233,965 (GRCm39) missense probably damaging 1.00
R1760:Baz1b UTSW 5 135,271,378 (GRCm39) missense probably benign
R1951:Baz1b UTSW 5 135,245,593 (GRCm39) missense probably benign 0.11
R2058:Baz1b UTSW 5 135,246,079 (GRCm39) missense probably benign 0.02
R2060:Baz1b UTSW 5 135,233,968 (GRCm39) missense probably damaging 1.00
R2142:Baz1b UTSW 5 135,246,129 (GRCm39) missense probably damaging 1.00
R2496:Baz1b UTSW 5 135,239,629 (GRCm39) missense probably damaging 1.00
R4088:Baz1b UTSW 5 135,245,794 (GRCm39) missense probably damaging 0.96
R4784:Baz1b UTSW 5 135,246,267 (GRCm39) missense possibly damaging 0.51
R4785:Baz1b UTSW 5 135,246,267 (GRCm39) missense possibly damaging 0.51
R5386:Baz1b UTSW 5 135,266,913 (GRCm39) missense probably damaging 1.00
R5653:Baz1b UTSW 5 135,237,951 (GRCm39) missense probably benign 0.20
R5808:Baz1b UTSW 5 135,250,812 (GRCm39) missense probably benign 0.00
R6010:Baz1b UTSW 5 135,246,305 (GRCm39) missense possibly damaging 0.82
R6014:Baz1b UTSW 5 135,246,248 (GRCm39) missense probably damaging 1.00
R6173:Baz1b UTSW 5 135,271,361 (GRCm39) missense probably benign
R6194:Baz1b UTSW 5 135,272,744 (GRCm39) missense probably damaging 0.99
R6419:Baz1b UTSW 5 135,271,348 (GRCm39) missense probably benign
R6435:Baz1b UTSW 5 135,266,799 (GRCm39) missense probably damaging 1.00
R7078:Baz1b UTSW 5 135,246,293 (GRCm39) missense probably benign 0.04
R7341:Baz1b UTSW 5 135,251,970 (GRCm39) missense probably damaging 1.00
R7683:Baz1b UTSW 5 135,246,582 (GRCm39) missense probably damaging 0.97
R7922:Baz1b UTSW 5 135,260,533 (GRCm39) missense probably damaging 0.99
R8188:Baz1b UTSW 5 135,233,916 (GRCm39) missense probably benign 0.12
R8429:Baz1b UTSW 5 135,246,185 (GRCm39) missense probably benign 0.01
R8436:Baz1b UTSW 5 135,266,821 (GRCm39) missense probably damaging 1.00
R8489:Baz1b UTSW 5 135,245,709 (GRCm39) missense probably damaging 1.00
R8688:Baz1b UTSW 5 135,271,343 (GRCm39) missense probably benign 0.01
R8771:Baz1b UTSW 5 135,273,151 (GRCm39) missense probably benign 0.19
R8832:Baz1b UTSW 5 135,246,230 (GRCm39) missense possibly damaging 0.95
R9086:Baz1b UTSW 5 135,260,538 (GRCm39) missense probably damaging 1.00
R9192:Baz1b UTSW 5 135,239,648 (GRCm39) missense possibly damaging 0.93
R9340:Baz1b UTSW 5 135,246,729 (GRCm39) missense probably benign 0.09
R9356:Baz1b UTSW 5 135,239,653 (GRCm39) missense probably benign 0.08
R9448:Baz1b UTSW 5 135,239,656 (GRCm39) missense probably damaging 1.00
R9507:Baz1b UTSW 5 135,233,971 (GRCm39) missense probably damaging 1.00
R9559:Baz1b UTSW 5 135,216,532 (GRCm39) missense probably benign 0.05
R9651:Baz1b UTSW 5 135,252,022 (GRCm39) missense probably benign
R9694:Baz1b UTSW 5 135,273,094 (GRCm39) missense probably benign 0.00
X0027:Baz1b UTSW 5 135,245,746 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCGAGCTCTATAACTGCC -3'
(R):5'- CAAGAGCTTGCCTTTGCTGG -3'

Sequencing Primer
(F):5'- AGCTCTATAACTGCCGCGGC -3'
(R):5'- CTTTGCTGGAAAAAGGCCCCATG -3'
Posted On 2015-07-06