Incidental Mutation 'R4397:Mex3b'
ID 325537
Institutional Source Beutler Lab
Gene Symbol Mex3b
Ensembl Gene ENSMUSG00000057706
Gene Name mex3 RNA binding family member B
Synonyms Rkhd3, 4931439A04Rik
MMRRC Submission 041685-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.541) question?
Stock # R4397 (G1)
Quality Score 144
Status Validated
Chromosome 7
Chromosomal Location 82516541-82520723 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82519031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 449 (S449P)
Ref Sequence ENSEMBL: ENSMUSP00000082168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082237]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000082237
AA Change: S449P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082168
Gene: ENSMUSG00000057706
AA Change: S449P

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 35 61 N/A INTRINSIC
KH 71 139 2.54e-9 SMART
KH 166 233 1.6e-15 SMART
low complexity region 262 270 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 389 424 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 494 515 N/A INTRINSIC
RING 525 564 3.24e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209046
Meta Mutation Damage Score 0.0702 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding phosphoprotein that is part of the MEX3 (muscle excess 3) family of translational regulators. The encoded protein contains N-terminal nuclear export and nuclear localization signals and is exported from the cytoplasm to the nucleus. The protein binds to RNA via two KH domains and also colocalizes with MEX3A, Dcp1A decapping factor and Argonaute proteins within P (processing) bodies. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous inactivation of this gene leads to partial neonatal lethality, decreased body weight and subfertility. Males show seminiferous tubule obstruction, oligozoospermia, abnormalities in Sertoli cell barrier morphology and function, and impaired Sertoli cell and macrophage phagocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 55,977,703 (GRCm39) L2193V probably damaging Het
Agap2 G A 10: 126,926,352 (GRCm39) A866T unknown Het
Aig1 A C 10: 13,528,726 (GRCm39) S237A probably benign Het
Baz1b C T 5: 135,273,300 (GRCm39) R1475W probably damaging Het
Bmp1 C T 14: 70,727,982 (GRCm39) probably null Het
Crybg3 A G 16: 59,380,458 (GRCm39) probably benign Het
Dnajc15 T C 14: 78,112,234 (GRCm39) probably null Het
Fam135b T A 15: 71,320,525 (GRCm39) H1334L probably benign Het
Fancg A T 4: 43,008,897 (GRCm39) H113Q probably benign Het
Gfap G A 11: 102,787,810 (GRCm39) A45V probably benign Het
Gjd3 A T 11: 98,873,247 (GRCm39) L199Q probably damaging Het
Gvin-ps3 A G 7: 105,682,130 (GRCm39) noncoding transcript Het
H13 A G 2: 152,519,472 (GRCm39) D65G probably damaging Het
Hcls1 T C 16: 36,757,662 (GRCm39) V5A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Iqgap3 T C 3: 88,011,665 (GRCm39) Y817H probably damaging Het
Iqsec2 C T X: 150,992,049 (GRCm39) T562I probably damaging Het
Klb A G 5: 65,537,382 (GRCm39) Y904C probably damaging Het
Kremen1 A T 11: 5,149,610 (GRCm39) S354T probably benign Het
Lamc3 A G 2: 31,821,964 (GRCm39) E1304G probably benign Het
Lrp4 T C 2: 91,342,015 (GRCm39) V1876A probably benign Het
Magi3 T C 3: 104,127,030 (GRCm39) T85A probably damaging Het
Map3k12 C T 15: 102,409,694 (GRCm39) A694T probably benign Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nars2 T C 7: 96,622,771 (GRCm39) probably null Het
Nlrp1a T G 11: 70,988,030 (GRCm39) M1046L probably benign Het
Nphs1 T G 7: 30,181,390 (GRCm39) probably null Het
Nup133 G A 8: 124,671,040 (GRCm39) T119M probably benign Het
Or6c201 G T 10: 128,969,450 (GRCm39) N62K possibly damaging Het
Pcdhga9 A T 18: 37,871,694 (GRCm39) I508F probably damaging Het
Phactr3 A G 2: 177,817,199 (GRCm39) probably benign Het
Plcb3 T C 19: 6,943,193 (GRCm39) K155E probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Prss38 T C 11: 59,263,854 (GRCm39) Y286C probably damaging Het
Psg16 T C 7: 16,824,623 (GRCm39) S45P possibly damaging Het
Ptpn21 G T 12: 98,654,507 (GRCm39) P820Q probably damaging Het
Ptpn21 A G 12: 98,681,319 (GRCm39) V105A probably damaging Het
Rnf7 A G 9: 96,360,463 (GRCm39) M58T probably benign Het
Slc25a11 G A 11: 70,535,677 (GRCm39) A287V probably benign Het
Slit2 G T 5: 48,377,423 (GRCm39) probably null Het
Suco A G 1: 161,672,421 (GRCm39) Y460H probably damaging Het
Tnxb C T 17: 34,897,636 (GRCm39) Q804* probably null Het
Trpv6 A G 6: 41,602,172 (GRCm39) I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Virma A G 4: 11,513,901 (GRCm39) E585G possibly damaging Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Vmn2r88 A T 14: 51,655,435 (GRCm39) D549V probably damaging Het
Other mutations in Mex3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Mex3b APN 7 82,518,116 (GRCm39) missense probably damaging 1.00
IGL01112:Mex3b APN 7 82,518,911 (GRCm39) missense probably benign 0.41
IGL01490:Mex3b APN 7 82,519,035 (GRCm39) missense possibly damaging 0.71
IGL01809:Mex3b APN 7 82,518,920 (GRCm39) missense probably benign
IGL02328:Mex3b APN 7 82,518,920 (GRCm39) missense probably benign
R0218:Mex3b UTSW 7 82,518,312 (GRCm39) missense probably damaging 1.00
R0653:Mex3b UTSW 7 82,518,242 (GRCm39) missense probably damaging 1.00
R2360:Mex3b UTSW 7 82,517,070 (GRCm39) missense probably benign 0.16
R4184:Mex3b UTSW 7 82,519,238 (GRCm39) missense probably benign 0.00
R4771:Mex3b UTSW 7 82,518,273 (GRCm39) missense possibly damaging 0.81
R4945:Mex3b UTSW 7 82,519,382 (GRCm39) missense probably benign 0.03
R5189:Mex3b UTSW 7 82,518,459 (GRCm39) missense probably damaging 0.96
R6962:Mex3b UTSW 7 82,518,473 (GRCm39) missense probably benign 0.00
R7021:Mex3b UTSW 7 82,519,080 (GRCm39) missense possibly damaging 0.49
R7381:Mex3b UTSW 7 82,518,073 (GRCm39) missense possibly damaging 0.85
R7483:Mex3b UTSW 7 82,517,114 (GRCm39) missense possibly damaging 0.89
R8398:Mex3b UTSW 7 82,518,842 (GRCm39) missense probably benign 0.03
R9288:Mex3b UTSW 7 82,518,159 (GRCm39) missense probably benign 0.02
RF009:Mex3b UTSW 7 82,516,968 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATCTGCAGCACCAGTATCC -3'
(R):5'- TCGAAGCACACAGAGCAGTC -3'

Sequencing Primer
(F):5'- GATCTGCAGCACCAGTATCCTCTTC -3'
(R):5'- TTTGCGCCTCAGCCCAGAG -3'
Posted On 2015-07-06