Incidental Mutation 'R4397:Homer3'
ID 325541
Institutional Source Beutler Lab
Gene Symbol Homer3
Ensembl Gene ENSMUSG00000003573
Gene Name homer scaffolding protein 3
Synonyms
MMRRC Submission 041685-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R4397 (G1)
Quality Score 179
Status Validated
Chromosome 8
Chromosomal Location 70735529-70747011 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 70742793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000087467] [ENSMUST00000110124] [ENSMUST00000140212]
AlphaFold Q99JP6
Predicted Effect possibly damaging
Transcript: ENSMUST00000003669
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000008004
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087467
SMART Domains Protein: ENSMUSP00000084735
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
Pfam:WH1 1 107 4.2e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110124
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127094
Predicted Effect probably null
Transcript: ENSMUST00000135368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135692
Predicted Effect possibly damaging
Transcript: ENSMUST00000140212
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 282 339 2e-10 PDB
low complexity region 340 355 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144890
Meta Mutation Damage Score 0.3504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants exhibit normal sensitivity to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 55,977,703 (GRCm39) L2193V probably damaging Het
Agap2 G A 10: 126,926,352 (GRCm39) A866T unknown Het
Aig1 A C 10: 13,528,726 (GRCm39) S237A probably benign Het
Baz1b C T 5: 135,273,300 (GRCm39) R1475W probably damaging Het
Bmp1 C T 14: 70,727,982 (GRCm39) probably null Het
Crybg3 A G 16: 59,380,458 (GRCm39) probably benign Het
Dnajc15 T C 14: 78,112,234 (GRCm39) probably null Het
Fam135b T A 15: 71,320,525 (GRCm39) H1334L probably benign Het
Fancg A T 4: 43,008,897 (GRCm39) H113Q probably benign Het
Gfap G A 11: 102,787,810 (GRCm39) A45V probably benign Het
Gjd3 A T 11: 98,873,247 (GRCm39) L199Q probably damaging Het
Gvin-ps3 A G 7: 105,682,130 (GRCm39) noncoding transcript Het
H13 A G 2: 152,519,472 (GRCm39) D65G probably damaging Het
Hcls1 T C 16: 36,757,662 (GRCm39) V5A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Iqgap3 T C 3: 88,011,665 (GRCm39) Y817H probably damaging Het
Iqsec2 C T X: 150,992,049 (GRCm39) T562I probably damaging Het
Klb A G 5: 65,537,382 (GRCm39) Y904C probably damaging Het
Kremen1 A T 11: 5,149,610 (GRCm39) S354T probably benign Het
Lamc3 A G 2: 31,821,964 (GRCm39) E1304G probably benign Het
Lrp4 T C 2: 91,342,015 (GRCm39) V1876A probably benign Het
Magi3 T C 3: 104,127,030 (GRCm39) T85A probably damaging Het
Map3k12 C T 15: 102,409,694 (GRCm39) A694T probably benign Het
Mex3b T C 7: 82,519,031 (GRCm39) S449P possibly damaging Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nars2 T C 7: 96,622,771 (GRCm39) probably null Het
Nlrp1a T G 11: 70,988,030 (GRCm39) M1046L probably benign Het
Nphs1 T G 7: 30,181,390 (GRCm39) probably null Het
Nup133 G A 8: 124,671,040 (GRCm39) T119M probably benign Het
Or6c201 G T 10: 128,969,450 (GRCm39) N62K possibly damaging Het
Pcdhga9 A T 18: 37,871,694 (GRCm39) I508F probably damaging Het
Phactr3 A G 2: 177,817,199 (GRCm39) probably benign Het
Plcb3 T C 19: 6,943,193 (GRCm39) K155E probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Prss38 T C 11: 59,263,854 (GRCm39) Y286C probably damaging Het
Psg16 T C 7: 16,824,623 (GRCm39) S45P possibly damaging Het
Ptpn21 G T 12: 98,654,507 (GRCm39) P820Q probably damaging Het
Ptpn21 A G 12: 98,681,319 (GRCm39) V105A probably damaging Het
Rnf7 A G 9: 96,360,463 (GRCm39) M58T probably benign Het
Slc25a11 G A 11: 70,535,677 (GRCm39) A287V probably benign Het
Slit2 G T 5: 48,377,423 (GRCm39) probably null Het
Suco A G 1: 161,672,421 (GRCm39) Y460H probably damaging Het
Tnxb C T 17: 34,897,636 (GRCm39) Q804* probably null Het
Trpv6 A G 6: 41,602,172 (GRCm39) I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Virma A G 4: 11,513,901 (GRCm39) E585G possibly damaging Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Vmn2r88 A T 14: 51,655,435 (GRCm39) D549V probably damaging Het
Other mutations in Homer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Homer3 APN 8 70,742,807 (GRCm39) missense probably damaging 0.96
IGL02493:Homer3 APN 8 70,742,721 (GRCm39) missense probably benign 0.00
IGL03134:Homer3 UTSW 8 70,738,985 (GRCm39) missense probably benign 0.00
R2436:Homer3 UTSW 8 70,745,706 (GRCm39) missense possibly damaging 0.91
R3508:Homer3 UTSW 8 70,744,005 (GRCm39) missense probably benign 0.06
R4391:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4392:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4395:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4396:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4401:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4402:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4445:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4446:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4482:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4488:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4489:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4664:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4666:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4751:Homer3 UTSW 8 70,738,084 (GRCm39) missense probably damaging 1.00
R5071:Homer3 UTSW 8 70,744,005 (GRCm39) missense probably benign
R5828:Homer3 UTSW 8 70,738,956 (GRCm39) missense probably benign 0.02
R6052:Homer3 UTSW 8 70,744,076 (GRCm39) nonsense probably null
R6211:Homer3 UTSW 8 70,738,174 (GRCm39) missense probably damaging 1.00
R6234:Homer3 UTSW 8 70,743,815 (GRCm39) critical splice donor site probably null
R6895:Homer3 UTSW 8 70,737,955 (GRCm39) missense probably damaging 0.99
R6914:Homer3 UTSW 8 70,744,201 (GRCm39) missense probably benign 0.00
R6942:Homer3 UTSW 8 70,744,201 (GRCm39) missense probably benign 0.00
R7300:Homer3 UTSW 8 70,737,953 (GRCm39) start codon destroyed probably null 0.23
R7391:Homer3 UTSW 8 70,742,134 (GRCm39) missense probably benign 0.00
R7553:Homer3 UTSW 8 70,742,774 (GRCm39) missense probably benign 0.02
R7555:Homer3 UTSW 8 70,742,063 (GRCm39) missense probably damaging 1.00
R7721:Homer3 UTSW 8 70,743,662 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAATACCCCAGTGGCTTCAATC -3'
(R):5'- TTAGTGACAATCAAGACCCTGAC -3'

Sequencing Primer
(F):5'- CCAGTGGCTTCAATCAACTTTAC -3'
(R):5'- AATTTCTGAGTTCGAGGCCAGC -3'
Posted On 2015-07-06