Mutagenetix > Incidental Mutations

Incidental Mutation 'R4397:Homer3'

325541

Institutional Source

Beutler Lab

Gene Symbol

Homer3

Ensembl Gene

ENSMUSG00000003573

Gene Name

homer scaffolding protein 3

Synonyms

MMRRC Submission

041685-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R4397 (G1)

Quality Score

179

Status

Validated

Chromosome

Chromosomal Location

70282827-70294361 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 70290143 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000087467] [ENSMUST00000110124] [ENSMUST00000140212]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003669
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573
AA Change: R168Q

Domain	Start	End	E-Value	Type
WH1	4	110	4.92e-37	SMART
low complexity region	198	210	N/A	INTRINSIC
PDB:3CVF\|D	285	342	2e-10	PDB
low complexity region	343	358	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000008004

SMART Domains

Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

Domain	Start	End	E-Value	Type
DEXDc	21	222	1.85e-57	SMART
HELICc	262	343	2.41e-29	SMART
low complexity region	369	383	N/A	INTRINSIC
low complexity region	461	470	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087467

SMART Domains

Protein: ENSMUSP00000084735
Gene: ENSMUSG00000003573

Domain	Start	End	E-Value	Type
Pfam:WH1	1	107	4.2e-36	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110124
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573
AA Change: R168Q

Domain	Start	End	E-Value	Type
WH1	4	110	4.92e-37	SMART
low complexity region	198	210	N/A	INTRINSIC
PDB:3CVF\|D	285	342	2e-10	PDB
low complexity region	343	358	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127094

Predicted Effect

probably null
Transcript: ENSMUST00000135368

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135692

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140212
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573
AA Change: R168Q

Domain	Start	End	E-Value	Type
WH1	4	110	4.92e-37	SMART
low complexity region	198	210	N/A	INTRINSIC
PDB:3CVF\|D	282	339	2e-10	PDB
low complexity region	340	355	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155711

Meta Mutation Damage Score

0.3504

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants exhibit normal sensitivity to cocaine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg4	T	G	X: 56,932,343	L2193V	probably damaging	Het
Agap2	G	A	10: 127,090,483	A866T	unknown	Het
Aig1	A	C	10: 13,652,982	S237A	probably benign	Het
Baz1b	C	T	5: 135,244,446	R1475W	probably damaging	Het
Bmp1	C	T	14: 70,490,542		probably null	Het
Crybg3	A	G	16: 59,560,095		probably benign	Het
Dnajc15	T	C	14: 77,874,794		probably null	Het
Fam135b	T	A	15: 71,448,676	H1334L	probably benign	Het
Fancg	A	T	4: 43,008,897	H113Q	probably benign	Het
Gfap	G	A	11: 102,896,984	A45V	probably benign	Het
Gjd3	A	T	11: 98,982,421	L199Q	probably damaging	Het
Gm8979	A	G	7: 106,082,923		noncoding transcript	Het
H13	A	G	2: 152,677,552	D65G	probably damaging	Het
Hcls1	T	C	16: 36,937,300	V5A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Iqgap3	T	C	3: 88,104,358	Y817H	probably damaging	Het
Iqsec2	C	T	X: 152,209,053	T562I	probably damaging	Het
Klb	A	G	5: 65,380,039	Y904C	probably damaging	Het
Kremen1	A	T	11: 5,199,610	S354T	probably benign	Het
Lamc3	A	G	2: 31,931,952	E1304G	probably benign	Het
Lrp4	T	C	2: 91,511,670	V1876A	probably benign	Het
Magi3	T	C	3: 104,219,714	T85A	probably damaging	Het
Map3k12	C	T	15: 102,501,259	A694T	probably benign	Het
Mex3b	T	C	7: 82,869,823	S449P	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nars2	T	C	7: 96,973,564		probably null	Het
Nlrp1a	T	G	11: 71,097,204	M1046L	probably benign	Het
Nphs1	T	G	7: 30,481,965		probably null	Het
Nup133	G	A	8: 123,944,301	T119M	probably benign	Het
Olfr770	G	T	10: 129,133,581	N62K	possibly damaging	Het
Pcdhga9	A	T	18: 37,738,641	I508F	probably damaging	Het
Phactr3	A	G	2: 178,175,406		probably benign	Het
Plcb3	T	C	19: 6,965,825	K155E	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Prss38	T	C	11: 59,373,028	Y286C	probably damaging	Het
Psg16	T	C	7: 17,090,698	S45P	possibly damaging	Het
Ptpn21	G	T	12: 98,688,248	P820Q	probably damaging	Het
Ptpn21	A	G	12: 98,715,060	V105A	probably damaging	Het
Rnf7	A	G	9: 96,478,410	M58T	probably benign	Het
Slc25a11	G	A	11: 70,644,851	A287V	probably benign	Het
Slit2	G	T	5: 48,220,081		probably null	Het
Suco	A	G	1: 161,844,852	Y460H	probably damaging	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Trpv6	A	G	6: 41,625,238	I379T	possibly damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Virma	A	G	4: 11,513,901	E585G	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Vmn2r88	A	T	14: 51,417,978	D549V	probably damaging	Het

Other mutations in Homer3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01966:Homer3	APN	8	70290157	missense	probably damaging	0.96
IGL02493:Homer3	APN	8	70290071	missense	probably benign	0.00
IGL03134:Homer3	UTSW	8	70286335	missense	probably benign	0.00
R2436:Homer3	UTSW	8	70293056	missense	possibly damaging	0.91
R3508:Homer3	UTSW	8	70291355	missense	probably benign	0.06
R4391:Homer3	UTSW	8	70290143	splice site	probably null
R4392:Homer3	UTSW	8	70290143	splice site	probably null
R4395:Homer3	UTSW	8	70290143	splice site	probably null
R4396:Homer3	UTSW	8	70290143	splice site	probably null
R4401:Homer3	UTSW	8	70290143	splice site	probably null
R4402:Homer3	UTSW	8	70290143	splice site	probably null
R4445:Homer3	UTSW	8	70290143	splice site	probably null
R4446:Homer3	UTSW	8	70290143	splice site	probably null
R4482:Homer3	UTSW	8	70290143	splice site	probably null
R4488:Homer3	UTSW	8	70290143	splice site	probably null
R4489:Homer3	UTSW	8	70290143	splice site	probably null
R4664:Homer3	UTSW	8	70290143	splice site	probably null
R4666:Homer3	UTSW	8	70290143	splice site	probably null
R4751:Homer3	UTSW	8	70285434	missense	probably damaging	1.00
R5071:Homer3	UTSW	8	70291355	missense	probably benign
R5828:Homer3	UTSW	8	70286306	missense	probably benign	0.02
R6052:Homer3	UTSW	8	70291426	nonsense	probably null
R6211:Homer3	UTSW	8	70285524	missense	probably damaging	1.00
R6234:Homer3	UTSW	8	70291165	critical splice donor site	probably null
R6895:Homer3	UTSW	8	70285305	missense	probably damaging	0.99
R6914:Homer3	UTSW	8	70291551	missense	probably benign	0.00
R6942:Homer3	UTSW	8	70291551	missense	probably benign	0.00
R7300:Homer3	UTSW	8	70285303	start codon destroyed	probably null	0.23
R7391:Homer3	UTSW	8	70289484	missense	probably benign	0.00
R7553:Homer3	UTSW	8	70290124	missense	probably benign	0.02
R7555:Homer3	UTSW	8	70289413	missense	probably damaging	1.00
R7721:Homer3	UTSW	8	70291012	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CAATACCCCAGTGGCTTCAATC -3'
(R):5'- TTAGTGACAATCAAGACCCTGAC -3'

Sequencing Primer
(F):5'- CCAGTGGCTTCAATCAACTTTAC -3'
(R):5'- AATTTCTGAGTTCGAGGCCAGC -3'

Posted On

2015-07-06