Incidental Mutation 'R4397:Nup133'
ID325542
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Namenucleoporin 133
Synonymsmermaid, 4832420O05Rik
MMRRC Submission 041685-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4397 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123897123-123949265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123944301 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 119 (T119M)
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000044795
AA Change: T119M

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: T119M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212133
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Agap2 G A 10: 127,090,483 A866T unknown Het
Aig1 A C 10: 13,652,982 S237A probably benign Het
Baz1b C T 5: 135,244,446 R1475W probably damaging Het
Bmp1 C T 14: 70,490,542 probably null Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dnajc15 T C 14: 77,874,794 probably null Het
Fam135b T A 15: 71,448,676 H1334L probably benign Het
Fancg A T 4: 43,008,897 H113Q probably benign Het
Gfap G A 11: 102,896,984 A45V probably benign Het
Gjd3 A T 11: 98,982,421 L199Q probably damaging Het
Gm8979 A G 7: 106,082,923 noncoding transcript Het
H13 A G 2: 152,677,552 D65G probably damaging Het
Hcls1 T C 16: 36,937,300 V5A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Iqgap3 T C 3: 88,104,358 Y817H probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Klb A G 5: 65,380,039 Y904C probably damaging Het
Kremen1 A T 11: 5,199,610 S354T probably benign Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lrp4 T C 2: 91,511,670 V1876A probably benign Het
Magi3 T C 3: 104,219,714 T85A probably damaging Het
Map3k12 C T 15: 102,501,259 A694T probably benign Het
Mex3b T C 7: 82,869,823 S449P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 96,973,564 probably null Het
Nlrp1a T G 11: 71,097,204 M1046L probably benign Het
Nphs1 T G 7: 30,481,965 probably null Het
Olfr770 G T 10: 129,133,581 N62K possibly damaging Het
Pcdhga9 A T 18: 37,738,641 I508F probably damaging Het
Phactr3 A G 2: 178,175,406 probably benign Het
Plcb3 T C 19: 6,965,825 K155E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psg16 T C 7: 17,090,698 S45P possibly damaging Het
Ptpn21 G T 12: 98,688,248 P820Q probably damaging Het
Ptpn21 A G 12: 98,715,060 V105A probably damaging Het
Rnf7 A G 9: 96,478,410 M58T probably benign Het
Slc25a11 G A 11: 70,644,851 A287V probably benign Het
Slit2 G T 5: 48,220,081 probably null Het
Suco A G 1: 161,844,852 Y460H probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpv6 A G 6: 41,625,238 I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Virma A G 4: 11,513,901 E585G possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vmn2r88 A T 14: 51,417,978 D549V probably damaging Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123939083 missense probably damaging 0.98
IGL00507:Nup133 APN 8 123918967 nonsense probably null
IGL00585:Nup133 APN 8 123909994 missense probably damaging 1.00
IGL00676:Nup133 APN 8 123906298 intron probably benign
IGL00966:Nup133 APN 8 123911906 missense probably damaging 0.98
IGL01069:Nup133 APN 8 123930982 nonsense probably null
IGL01553:Nup133 APN 8 123915324 missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123939130 nonsense probably null
IGL01730:Nup133 APN 8 123938233 missense probably benign 0.00
IGL01996:Nup133 APN 8 123946595 missense probably benign 0.00
IGL02332:Nup133 APN 8 123907832 missense probably damaging 1.00
IGL02552:Nup133 APN 8 123929255 missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123949083 missense probably benign 0.00
IGL03009:Nup133 APN 8 123933500 missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123946594 missense probably benign 0.11
Slant UTSW 8 123916281 splice site probably null
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0139:Nup133 UTSW 8 123929343 missense probably benign 0.00
R0344:Nup133 UTSW 8 123917446 missense possibly damaging 0.82
R0730:Nup133 UTSW 8 123949008 missense probably benign 0.00
R1301:Nup133 UTSW 8 123917417 intron probably benign
R1453:Nup133 UTSW 8 123915375 missense probably benign 0.00
R1570:Nup133 UTSW 8 123949176 start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123949035 missense probably benign 0.02
R1773:Nup133 UTSW 8 123930983 nonsense probably null
R1992:Nup133 UTSW 8 123906221 missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2065:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2066:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2068:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R4683:Nup133 UTSW 8 123930982 nonsense probably null
R4771:Nup133 UTSW 8 123929398 missense probably damaging 1.00
R4910:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123915196 missense probably benign 0.07
R5411:Nup133 UTSW 8 123927206 missense probably benign
R5470:Nup133 UTSW 8 123930966 missense probably benign 0.00
R5664:Nup133 UTSW 8 123906281 missense probably benign 0.01
R5907:Nup133 UTSW 8 123916299 missense possibly damaging 0.90
R6003:Nup133 UTSW 8 123938292 missense probably damaging 0.98
R6059:Nup133 UTSW 8 123914596 missense probably damaging 1.00
R6219:Nup133 UTSW 8 123936873 missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123917437 missense probably benign 0.01
R6672:Nup133 UTSW 8 123916281 splice site probably null
R6737:Nup133 UTSW 8 123906291 missense probably damaging 0.99
R6763:Nup133 UTSW 8 123944278 missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123899507 missense probably benign 0.08
R6975:Nup133 UTSW 8 123915318 missense probably damaging 0.99
R7101:Nup133 UTSW 8 123906227 missense possibly damaging 0.89
R7114:Nup133 UTSW 8 123915373 missense probably benign 0.00
R7271:Nup133 UTSW 8 123922414 missense probably benign 0.34
R7501:Nup133 UTSW 8 123922414 missense probably benign 0.34
R8054:Nup133 UTSW 8 123949217 intron probably benign
R8397:Nup133 UTSW 8 123922417 missense probably benign 0.17
R8703:Nup133 UTSW 8 123916282 critical splice donor site probably null
R8811:Nup133 UTSW 8 123911888 frame shift probably null
R8813:Nup133 UTSW 8 123911888 frame shift probably null
X0023:Nup133 UTSW 8 123909988 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCATGTTCATTCAGTTTGGC -3'
(R):5'- CAACTGCCTGTTTTGGAGAC -3'

Sequencing Primer
(F):5'- GAAGAACTCTTCCCTGCTGAG -3'
(R):5'- GGGGTTAACTGCATGTCTT -3'
Posted On2015-07-06