Incidental Mutation 'R4397:Agap2'
ID 325544
Institutional Source Beutler Lab
Gene Symbol Agap2
Ensembl Gene ENSMUSG00000025422
Gene Name ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Synonyms Centg1
MMRRC Submission 041685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock # R4397 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 127075284-127093169 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 127090483 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 866 (A866T)
Ref Sequence ENSEMBL: ENSMUSP00000151946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039259] [ENSMUST00000217941]
AlphaFold Q3UHD9
Predicted Effect unknown
Transcript: ENSMUST00000039259
AA Change: A886T
SMART Domains Protein: ENSMUSP00000043466
Gene: ENSMUSG00000025422
AA Change: A886T

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 137 149 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
low complexity region 222 257 N/A INTRINSIC
low complexity region 306 322 N/A INTRINSIC
low complexity region 349 376 N/A INTRINSIC
Pfam:Ras 402 562 3.6e-16 PFAM
low complexity region 575 590 N/A INTRINSIC
low complexity region 600 609 N/A INTRINSIC
PH 671 906 4.35e-14 SMART
ArfGap 925 1045 8.8e-62 SMART
low complexity region 1052 1071 N/A INTRINSIC
ANK 1084 1113 1.15e0 SMART
ANK 1117 1145 3.69e2 SMART
low complexity region 1148 1175 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217941
AA Change: A866T
Meta Mutation Damage Score 0.3547 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the centaurin GTPase family. This gene product regulates the activity of multiple kinases, including PI3K. Reduced expression of this gene results in multiple defects, including neural deficiencies, while increased expression of this gene has been observed in some tumors. Alternative splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lactation due to abnormal mammary gland growth during lactation, failure of insulin-suppressed gluconeogenesis, and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Aig1 A C 10: 13,652,982 S237A probably benign Het
Baz1b C T 5: 135,244,446 R1475W probably damaging Het
Bmp1 C T 14: 70,490,542 probably null Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dnajc15 T C 14: 77,874,794 probably null Het
Fam135b T A 15: 71,448,676 H1334L probably benign Het
Fancg A T 4: 43,008,897 H113Q probably benign Het
Gfap G A 11: 102,896,984 A45V probably benign Het
Gjd3 A T 11: 98,982,421 L199Q probably damaging Het
Gm8979 A G 7: 106,082,923 noncoding transcript Het
H13 A G 2: 152,677,552 D65G probably damaging Het
Hcls1 T C 16: 36,937,300 V5A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Iqgap3 T C 3: 88,104,358 Y817H probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Klb A G 5: 65,380,039 Y904C probably damaging Het
Kremen1 A T 11: 5,199,610 S354T probably benign Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lrp4 T C 2: 91,511,670 V1876A probably benign Het
Magi3 T C 3: 104,219,714 T85A probably damaging Het
Map3k12 C T 15: 102,501,259 A694T probably benign Het
Mex3b T C 7: 82,869,823 S449P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 96,973,564 probably null Het
Nlrp1a T G 11: 71,097,204 M1046L probably benign Het
Nphs1 T G 7: 30,481,965 probably null Het
Nup133 G A 8: 123,944,301 T119M probably benign Het
Olfr770 G T 10: 129,133,581 N62K possibly damaging Het
Pcdhga9 A T 18: 37,738,641 I508F probably damaging Het
Phactr3 A G 2: 178,175,406 probably benign Het
Plcb3 T C 19: 6,965,825 K155E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psg16 T C 7: 17,090,698 S45P possibly damaging Het
Ptpn21 G T 12: 98,688,248 P820Q probably damaging Het
Ptpn21 A G 12: 98,715,060 V105A probably damaging Het
Rnf7 A G 9: 96,478,410 M58T probably benign Het
Slc25a11 G A 11: 70,644,851 A287V probably benign Het
Slit2 G T 5: 48,220,081 probably null Het
Suco A G 1: 161,844,852 Y460H probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpv6 A G 6: 41,625,238 I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Virma A G 4: 11,513,901 E585G possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vmn2r88 A T 14: 51,417,978 D549V probably damaging Het
Other mutations in Agap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Agap2 APN 10 127087996 missense unknown
IGL01690:Agap2 APN 10 127082958 splice site probably benign
IGL01765:Agap2 APN 10 127083235 missense unknown
IGL02029:Agap2 APN 10 127080283 missense unknown
IGL02525:Agap2 APN 10 127083201 splice site probably null
IGL03019:Agap2 APN 10 127091562 splice site probably benign
R0086:Agap2 UTSW 10 127087882 splice site probably null
R0197:Agap2 UTSW 10 127091702 missense possibly damaging 0.66
R0345:Agap2 UTSW 10 127087895 missense unknown
R0363:Agap2 UTSW 10 127090965 missense probably damaging 1.00
R0682:Agap2 UTSW 10 127083482 missense unknown
R0787:Agap2 UTSW 10 127085150 missense unknown
R0882:Agap2 UTSW 10 127087450 missense unknown
R0883:Agap2 UTSW 10 127091702 missense possibly damaging 0.66
R1445:Agap2 UTSW 10 127091112 splice site probably benign
R1800:Agap2 UTSW 10 127091671 missense probably damaging 1.00
R1854:Agap2 UTSW 10 127080516 missense unknown
R1925:Agap2 UTSW 10 127090875 missense probably damaging 1.00
R1986:Agap2 UTSW 10 127083044 nonsense probably null
R2050:Agap2 UTSW 10 127080261 nonsense probably null
R2267:Agap2 UTSW 10 127082428 splice site probably benign
R2269:Agap2 UTSW 10 127082428 splice site probably benign
R4174:Agap2 UTSW 10 127090514 missense probably damaging 0.98
R4418:Agap2 UTSW 10 127091650 missense probably damaging 1.00
R4472:Agap2 UTSW 10 127091213 missense probably damaging 1.00
R4612:Agap2 UTSW 10 127080096 missense unknown
R4690:Agap2 UTSW 10 127091375 missense possibly damaging 0.91
R4744:Agap2 UTSW 10 127090203 critical splice donor site probably null
R5316:Agap2 UTSW 10 127082427 splice site probably null
R5533:Agap2 UTSW 10 127083042 missense probably damaging 1.00
R5680:Agap2 UTSW 10 127088011 missense unknown
R6010:Agap2 UTSW 10 127090910 missense probably damaging 1.00
R6276:Agap2 UTSW 10 127089360 critical splice donor site probably null
R6356:Agap2 UTSW 10 127082996 missense unknown
R7138:Agap2 UTSW 10 127087285 missense unknown
R7154:Agap2 UTSW 10 127091655 missense probably benign 0.34
R7497:Agap2 UTSW 10 127090965 missense probably damaging 0.99
R7718:Agap2 UTSW 10 127079865 missense possibly damaging 0.68
R7720:Agap2 UTSW 10 127091088 missense probably damaging 0.96
R7893:Agap2 UTSW 10 127080195 missense unknown
R7933:Agap2 UTSW 10 127086920 splice site probably benign
R8337:Agap2 UTSW 10 127088325 missense unknown
R8372:Agap2 UTSW 10 127089316 missense unknown
R8428:Agap2 UTSW 10 127087306 missense unknown
R8861:Agap2 UTSW 10 127090514 missense unknown
R9082:Agap2 UTSW 10 127083042 missense probably damaging 1.00
R9341:Agap2 UTSW 10 127091690 missense unknown
R9354:Agap2 UTSW 10 127087235 missense unknown
R9650:Agap2 UTSW 10 127091784 missense unknown
R9745:Agap2 UTSW 10 127083511 missense unknown
Z1088:Agap2 UTSW 10 127088242 missense unknown
Z1176:Agap2 UTSW 10 127080225 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAGCCAAGCGCAAAATGTG -3'
(R):5'- AGTTGAAGTTAGCTCTGGCAC -3'

Sequencing Primer
(F):5'- CATGTGCTCGGGCTTCCTG -3'
(R):5'- TGGCACAGCGTACCTCTGAC -3'
Posted On 2015-07-06