Incidental Mutation 'R4397:Or6c201'
ID 325545
Institutional Source Beutler Lab
Gene Symbol Or6c201
Ensembl Gene ENSMUSG00000047868
Gene Name olfactory receptor family 6 subfamily C member 201
Synonyms MOR114-5, Olfr770, GA_x6K02T2PULF-10819232-10818297
MMRRC Submission 041685-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R4397 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 128968700-128969635 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 128969450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 62 (N62K)
Ref Sequence ENSEMBL: ENSMUSP00000144960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062314] [ENSMUST00000203887] [ENSMUST00000204250] [ENSMUST00000204712]
AlphaFold Q8VGC2
Predicted Effect possibly damaging
Transcript: ENSMUST00000062314
AA Change: N62K

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055193
Gene: ENSMUSG00000047868
AA Change: N62K

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.2e-43 PFAM
Pfam:7tm_1 38 286 5.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203887
AA Change: N62K

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144950
Gene: ENSMUSG00000047868
AA Change: N62K

DomainStartEndE-ValueType
Pfam:7tm_4 28 107 1.5e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204250
AA Change: N62K

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144892
Gene: ENSMUSG00000047868
AA Change: N62K

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.2e-43 PFAM
Pfam:7tm_1 38 286 5.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204712
AA Change: N62K

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144960
Gene: ENSMUSG00000047868
AA Change: N62K

DomainStartEndE-ValueType
Pfam:7tm_4 28 130 1.4e-17 PFAM
Pfam:7TM_GPCR_Srsx 32 130 2.4e-4 PFAM
Pfam:7tm_1 38 130 8.8e-16 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 55,977,703 (GRCm39) L2193V probably damaging Het
Agap2 G A 10: 126,926,352 (GRCm39) A866T unknown Het
Aig1 A C 10: 13,528,726 (GRCm39) S237A probably benign Het
Baz1b C T 5: 135,273,300 (GRCm39) R1475W probably damaging Het
Bmp1 C T 14: 70,727,982 (GRCm39) probably null Het
Crybg3 A G 16: 59,380,458 (GRCm39) probably benign Het
Dnajc15 T C 14: 78,112,234 (GRCm39) probably null Het
Fam135b T A 15: 71,320,525 (GRCm39) H1334L probably benign Het
Fancg A T 4: 43,008,897 (GRCm39) H113Q probably benign Het
Gfap G A 11: 102,787,810 (GRCm39) A45V probably benign Het
Gjd3 A T 11: 98,873,247 (GRCm39) L199Q probably damaging Het
Gvin-ps3 A G 7: 105,682,130 (GRCm39) noncoding transcript Het
H13 A G 2: 152,519,472 (GRCm39) D65G probably damaging Het
Hcls1 T C 16: 36,757,662 (GRCm39) V5A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Iqgap3 T C 3: 88,011,665 (GRCm39) Y817H probably damaging Het
Iqsec2 C T X: 150,992,049 (GRCm39) T562I probably damaging Het
Klb A G 5: 65,537,382 (GRCm39) Y904C probably damaging Het
Kremen1 A T 11: 5,149,610 (GRCm39) S354T probably benign Het
Lamc3 A G 2: 31,821,964 (GRCm39) E1304G probably benign Het
Lrp4 T C 2: 91,342,015 (GRCm39) V1876A probably benign Het
Magi3 T C 3: 104,127,030 (GRCm39) T85A probably damaging Het
Map3k12 C T 15: 102,409,694 (GRCm39) A694T probably benign Het
Mex3b T C 7: 82,519,031 (GRCm39) S449P possibly damaging Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nars2 T C 7: 96,622,771 (GRCm39) probably null Het
Nlrp1a T G 11: 70,988,030 (GRCm39) M1046L probably benign Het
Nphs1 T G 7: 30,181,390 (GRCm39) probably null Het
Nup133 G A 8: 124,671,040 (GRCm39) T119M probably benign Het
Pcdhga9 A T 18: 37,871,694 (GRCm39) I508F probably damaging Het
Phactr3 A G 2: 177,817,199 (GRCm39) probably benign Het
Plcb3 T C 19: 6,943,193 (GRCm39) K155E probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Prss38 T C 11: 59,263,854 (GRCm39) Y286C probably damaging Het
Psg16 T C 7: 16,824,623 (GRCm39) S45P possibly damaging Het
Ptpn21 G T 12: 98,654,507 (GRCm39) P820Q probably damaging Het
Ptpn21 A G 12: 98,681,319 (GRCm39) V105A probably damaging Het
Rnf7 A G 9: 96,360,463 (GRCm39) M58T probably benign Het
Slc25a11 G A 11: 70,535,677 (GRCm39) A287V probably benign Het
Slit2 G T 5: 48,377,423 (GRCm39) probably null Het
Suco A G 1: 161,672,421 (GRCm39) Y460H probably damaging Het
Tnxb C T 17: 34,897,636 (GRCm39) Q804* probably null Het
Trpv6 A G 6: 41,602,172 (GRCm39) I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Virma A G 4: 11,513,901 (GRCm39) E585G possibly damaging Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Vmn2r88 A T 14: 51,655,435 (GRCm39) D549V probably damaging Het
Other mutations in Or6c201
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0787:Or6c201 UTSW 10 128,969,395 (GRCm39) missense possibly damaging 0.89
R2141:Or6c201 UTSW 10 128,968,875 (GRCm39) missense probably benign 0.23
R4190:Or6c201 UTSW 10 128,968,836 (GRCm39) missense possibly damaging 0.86
R5009:Or6c201 UTSW 10 128,969,484 (GRCm39) missense probably benign 0.06
R5781:Or6c201 UTSW 10 128,969,016 (GRCm39) missense probably damaging 1.00
R6343:Or6c201 UTSW 10 128,969,535 (GRCm39) nonsense probably null
R7492:Or6c201 UTSW 10 128,969,509 (GRCm39) missense probably damaging 0.99
R7530:Or6c201 UTSW 10 128,969,849 (GRCm39) splice site probably null
Z1088:Or6c201 UTSW 10 128,968,944 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- AGGCAGTGCTCATGATGGTG -3'
(R):5'- GAGGAACCATACAGTAACGACATTC -3'

Sequencing Primer
(F):5'- TTTGCAGATGGCCACATAGC -3'
(R):5'- TCATTCTCCTGGGACTAACAGAGG -3'
Posted On 2015-07-06